ENGINEERING AND DESIGN OF FELINE CELL-BASED IMMUNOTHERAPIES A Dissertation Presented to the Faculty of the Graduate School of Cornell University In Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy by James Robert Cockey May 2025 © 2025 James Robert Cockey ENGINEERING AND DESIGN OF FELINE CELL-BASED IMMUNOTHERAPIES James Robert Cockey, Ph. D. Cornell University 2025 Feline infectious peritonitis (FIP) is an invariably fatal disease in cats caused by a mutated version of feline coronavirus (FCoV). Although there is an antiviral that veterinarians can prescribe, not all patients respond and some those that do initially recover may relapse, stressing the need for alternative treatment modalities. One such alternative is known as chimeric antigen receptor (CAR) T cell therapy. Although most known for its success in treating human hematological malignancies, this treatment modality has recently gained more attention for potential use as an antiviral. Here, my goal was to demonstrate a proof of concept for CAR T cell therapy as a potential new treatment for FIP. In Chapter 1, I introduce the concept of immune cell therapy in veterinary medicine as well as the pathogenesis of FIP through a literature review. The conclusion of this review raises the important gap in new therapies for this devastating disease and proposes development of a CAR therapy. While CAR T cell therapy has been investigated in dogs, it has yet to be investigated at all in cats. To begin to address this gap, in Chapter 2, I develop optimized methods to activate and expand primary feline T cells using a combination of interleukin-2 with phorbol myristate acetate and ionomycin. I then demonstrate that these feline T cells can be genetically engineered using feline-immunodeficiency virus-based lentivirus transduction to functionally express a human CAR. With the ability to isolate, expand, and modify feline T cells, In Chapter 3 I then turned to developing an appropriate CAR construct for use in FIP. I design anti-FCoV CARs derived from an anti-spike monoclonal antibody with human signaling domains and demonstrate that these CAR constructs are specific and functional against spike-transfected and FCoV-infected target cells. In Chapter 4, I summarize the conclusions, and limitations, and future applications of this work. This thesis, to my knowledge, is the first preclinical demonstration that feline CAR T cells can be functionally generated using this methodology. It also serves as a proof of concept for CAR T cell therapy as an alternative treatment for FIP. This work serves a not only as a blueprint to expand the therapeutic options for FIP, but also advances research for a therapeutic approach that can be used for other devastating feline diseases such as lymphoma. v BIOGRAPHICAL SKETCH James Cockey grew up in Montclair, New Jersey, where growing up he had always wanted to become a veterinarian but had a blossoming curiosity for science. His interest in immunology, specifically, was first peaked in his high school biology class when he learned about strategies to redirect immune cells to eliminate tumors. At this point he knew that he wanted to enter the realm of research. He went on to attend Duke University where the summer entering his senior year he had his first formal research experience when he was accepted into the Summer Undergraduate Research in Pharmacology program. There he worked in the laboratory of Dr. Gerard Blobe, studying the effects of knocking out the downstream effects of knocking out transforming growth factor-b pathway member activin-like kinase 4 in Jurkat T cells. Staying in Dr. Blobe’s lab through the rest of his senior year as an independent study student, he found that knocking out this gene enhanced adhesion to fibronectin and chemotactic migration in these cells. This experience filled of formulating a scientific hypothesis and testing it experimentally filled him with passion for the scientific method and solidified his urge to pursue research as formal career. Following graduation, he worked as a Research Technician in the Center for Immune Cell Therapies at Memorial Sloan Kettering Cancer Center. During this experience he co-cultured primary human T cells from matched donor apheresis samples with antigen-presenting target cells to confer specificity, expanded them to clinical doses, and prepared them for infusion into patients with Epstein-Barr virus-associated lymphoma or immunocompromised cancer patients with concurrent cytomegalovirus infections for clinical trial testing. All of this work took place in a cell therapy production facility under good manufacturing practice conditions, which not only allowed him to gain an understanding of the regulatory guidelines necessary for vi clinical trial production, but it also allowed him to see up close the translational aspects of research in treating real patients. This work also took place in the same facility that was used for production of chimeric antigen receptor (CAR) T cells for B cell leukemia, a process which involves genetically engineering a patient’s T cells to target specific proteins on the surface of cancer cells. Through interactions with the clinical production staff of these cells as well as the original principal investigators behind the translational research, his excitement about using this treatment modality to help patients with many different diseases became a fervor. After finishing his time at Memorial Sloan Kettering, James began veterinary school at Cornell University, where after his second year he transitioned into the combined DVM/PhD program. For his thesis in Immunology & Infectious Disease he has been working in the laboratory of Dr. Cynthia Leifer after twice receiving the Liz Hanson Graduate Fellowship, where he has been able to take his passion for re-directing the immune system through CAR T cell therapy and apply it to feline infectious peritonitis (FIP), a devastating disease of cats caused by feline coronavirus infection. James hopes that once he becomes Veterinarian-Scientist then he can not only translate his thesis work into an efficacious treatment for FIP patients, but also adjust the therapeutic design such that it can be broadly utilized to treat other diseases as well, such as lymphoma. vii Dedicated to my maternal grandparents, James and Flora Brunson, who instilled in me the meaning of hard work and ensured that I received a proper education. In memory of Fred Hampton, Malcolm X, and all of the martyrs who made the ultimate sacrifice that illuminated the path for me to get to this point. viii ACKNOWLEDGMENTS To all of my family, thank you for providing me the environment in which I could pursue my dreams. To my mother, who worked tirelessly to provide me with everything I needed as a single mother, I cannot fully put into words my gratitude for all that you sacrificed for me to get here. To my aunt Emma and uncle David, thank you for providing me with a warm meal and a place to sleep whenever I needed a getaway. Isabelle, obrigado por tua ajuda e por creendo em minhas ideias locas. To Dr. Gerard Blobe, thank you for taking a chance on me and giving me my first opportunity to pursue research. To Dean Lorin Warnick, thank you for helping me start this journey in the first place, I will never take it for granted. To my collaborators in the Whittaker and DeLisa labs, thank you for patience in not only assisting me with technical assays, but also for educating me about the fundamentals of virology and protein engineering. To Drs. Susanna Babasyan and Bettina Wagner, thank you for your assistance with antibody purification strategy that allowed me to kickstart my PhD. To Dr. Carolyn McDaniel, , the CARE staff, the Feline Health Center, and all of our blood donors, I could not have moved this project forward without you. To Karla, Jingyi, and Lauren, thanks for being great lab mates and great friends who I knew I could confide in about anything. Gavin, Emily, Christina, and Christina, thank you for teaching me how to be mentor and role model. Lastly, thank you to my advisor Dr. Cynthia Leifer for taking me on as a student in the face of global and financial uncertainty. It’s incredible to think about how much I’ve grown as a scientist under your guidance, and I am truly grateful that you fully supported me in pursuing a high- risk thesis project and pushed me to become better every day that I came to lab. ix TABLE OF CONTENTS Abstract………………………………………………………………………………..iii Biographical Sketch……………………………………………………………………v Dedication…………………………………………………………………………….vii Acknowledgements…………………………………………………………………..viii Table of Contents……………………………………………………………………...ix List of Figures………………………………………………………………………..xiv List of Tables………………………………………………………………………...xv List of Abbreviations………………………………………………………………...xvi 1. Chapter 1: Introduction……………………………………………….....……....1 1.1. Introduction…………………………………………………………………....2 1.2. CAR Construct Design…………………………………………………….....4 1.3. Cell Manufacturing…………………………………………………………...7 1.4. Choosing the CAR Driver…….……………………………………………...8 1.4.1. T cells…………………………………………………………………..8 1.4.2. Natural killer cells…………………………………………………….11 1.4.3. Other cells…………………………………………………………….13 1.5. Applications Beyond Cancer………………………………………………...16 1.6. Feline Coronavirus…………………………………………………………...17 1.7. Clinical FIP………………………………………………………………….19 1.8. Discussion……………………………………………………………………22 1.9. REFERENCES………………………………………………………….…...24 2. Chapter 2: Generation of primary feline chimeric antigen receptor T cell….54 2.1. Introduction…………………………………………………..........................56 x 2.2. Methods……..………………………………………………..........................57 2.2.1. Primary feline T cell isolation………………………………………..57 2.2.2. T cell labeling and stimulation……………………………………….58 2.2.3. Flow cytometry………………………………………………………59 2.2.4. T cell expansion……………………………………………………...60 2.2.5. THelper cell polarization…………………………………………….....60 2.2.6. ELISA……………………………………………………….…….….61 2.2.7. 1928Z-LNGFR CAR vector cloning………………………………….61 2.2.8. Cell line culture…………………………………………..…………..62 2.2.9. Primary T cell lentiviral transduction………………………………..62 2.2.10. Cytotoxicity assay……………………………………………............63 2.2.11. CD19 deficient Raji cell generation………………………………….64 2.2.12. RNA isolation and cDNA preparation for polarized T cells………....65 2.2.13. qPCR for TH1 and Treg lineage cytokines and transcription factors…...66 2.2.14. Statistical analyses……………………………………………............67 2.3. Results……………………………………………………………………….69 2.3.1. ConA and PMA/I are potent stimuli for feline T cell proliferation an activation……………………………………………69 2.3.2. ConA and PMA/I combined with polarizing cytokines generates feline THelper subsets………………………………………..71 2.3.3. PMA/I yields greater ex vivo feline T cell expansion than ConA…………………………………………….........................74 2.3.4. Generation of functional primary feline CAR T cells………………...75 xi 2.4. Discussion…..………………………………………………………………..78 2.5. REFERENCES………………………………………………………………83 3. Chapter 3: Design of chimeric antigen receptor T cells to treat feline infectious peritonitis………………………………………………………..........89 3.1. Introduction…………………………………………………………………..90 3.2. Methods………………………………………………………………………93 3.2.1. Cell line culture……………………………..……………………..….93 3.2.2. Hybridoma cell culture and antibody purification…………..………..94 3.2.3. HEK293T transfection…………..……………………………………94 3.2.4. Surface and intracellular FCoV spike staining………………………95 3.2.5. Western blotting…………..………………………………………….96 3.2.6. Hybridoma RNA isolation, reverse transcription, and cDNA synthesis…………..…………………………………………..97 3.2.7. 18A7.4 VL and VH cloning and sequencing…………..……………..97 3.2.8. Generation of an 18A7.4 anti-spike CAR…………..………………..99 3.2.9. Lentiviral production and Jurkat transduction…………..…………..99 3.2.10. CAR Jurkat CD69 co-incubation assay…………..………………...100 3.2.11. FCoV production…………..………………………………………..101 3.2.12. Plaque assay to titer FCoV…………..………………………………101 3.2.13. CAR T cell activation by FCoV-infected Fcwf-4CU cells…………102 3.2.14. pCDNA-EGFP cloning and in vitro transcription…………..………102 3.2.15. Primary T cell nucleofection…………..……………………………103 3.2.16. Feline gene cloning…………..……………………………………...104 xii 3.2.17. Felinized anti-spike CAR construction…………..………….………104 3.2.18. Statistical analysis…………..………………………………………106 3.3. Results………………………………………………………………………106 3.3.1. Monoclonal antibody 18A7.4 recognizes a linear epitope in Types I and II FCoV spike………………………………………106 3.3.2. mAb 187A.4 specifically binds native Type II but not Type I FCoV spike…………………………………………………..…..….109 3.3.3. Anti-spike CAR T cells demonstrate functionality using 18A7.4 ScFv…………..……………………………………………..110 3.3.4. mRNA nucleofection successfully expresses exogenous genes in feline T cells…………..…………………………………...113 3.3.5. Felinized anti-spike CAR stably expressed in mammalian cells……116 3.4. Discussion…………………………………………………………………..117 3.5. REFERENCES……………………………………………………………..121 4. Chapter 4: Conclusions, limitations, and future directions…………………130 4.1. Summary of Findings………………………………………………………131 4.2. Limitations of Chapter 2……………………………………………………134 4.3. Limitations of Chapter 3……………………………………………………136 4.4. Research Impact…………………………………………………………….138 4.5. Future Directions…………………………………………………………...139 4.5.1. Allogeneic cell sourcing…………..………………………………...139 4.5.2. GMP cell manufacturing………………………………………..…..142 4.5.3. Clinical product design for FIP……………………………………..144 4.5.4. Applications to other feline diseases………………………………..147 4.6. Concluding Remarks……………………………………………………….150 xiii 4.7. REFERENCES……………………………………………………………..151 5. APPENDIX……………………………………………………………………..157 xiv LIST OF FIGURES Chapter 1 Figure 1.1 Overall scheme for CAR therapy in veterinary medicine………………...6 Figure 1.2 Alternative immune cells besides T cells that have been investigated as “CAR Drivers” in cancer immunotherapy………………………...…14 Chapter 2 Figure 2.1 Gating strategy for feline T cells………………………….........................67 Figure 2.2 ConA and PMA/I are potent stimuli for feline T cell proliferation and activation…………………………………………………………………………70 Figure 2.3 Primary feline T cells polarized with T helper cytokine milieu upregulate lineage cytokine expression and secretion………………………………..73 Figure 2.4 PMA/I stimulation yields greater ex vivo expansion of primary feline T cells than ConA…………………………………………………………..….75 Figure 2.5 Primary feline CAR T cells generated by lentiviral transduction………...76 Chapter 3 Figure 3.1 Anti-spike mAb 18A7.4 detects type I and type II coronavirus spike proteins by western blot…………………………..………………………………....108 Figure 3.2 Surface and intracellular recognition of native Types I and II FCoV spike by 18A7.4……………………;…………………………………………...…..110 Figure 3.3 Design and functionality of an anti-spike CAR………………..………...111 Figure 3.4 Nucleofection of primary feline T cells………………………………….115 Figure 3.5 Expression of felinized anti-spike CARs in mammalian cells…………..117 Chapter 4 Figure 4.1 Proposed clinical product design of CAR+ cells for the treatment of FIP……………………………………………………………………………...…146 xv LIST OF TABLES Chapter 1 Table 1.1 Summary of species-specific surface markers that define immune cells and can be used to enrich desired populations through FACS or magnetic bead enrichment……………………………………………………………10 Chapter 2 Table 2.1 Characteristics of healthy female domestic short hair donor cats used in this study…………………………………………….......................................67 Table 2.2 Dilutions of antibodies used for flow cytometry staining and CD3 MACS enrichment of T cells. ………………………..................................................68 Table 2.3 Forward and reverse primer sequences for used for quantitative PCR of TH1 and Treg lineage cytokines and transcription factors………………….....68 Chapter 3 Table 3.1 Forward and reverse primers used in second PCR reaction to attach sites for AflII and XbaI (bold) to the PCR fragments encoding the VL and VH regions of anti-spike clone 18A7.4………………….….......98 APPENDIX Table A1 Key supplies used in experiments……………… ……………………….157 Table A2 Key reagents used in experiments……………….………………………..158 Table A3 Key equipment used in experiments……………………………………...162 Table A4 Key antibodies used in flow cytometry experiments with dilutions……...163 Table A5 Cell lines utilized for experiments………………………………………..164 Table A6 Key plasmids utilized for experiments……………………………………165 xvi LIST OF ABBREVIATIONS aAPC Artificial antigen presenting cell ACT Adoptive cell therapy ADE Antibody-dependent enhancement ANOVA Analysis of variance CAR Chimeric antigen receptor cDNA Complementary deoxyribonucleic acid ConA Concanavalin A CMV Cytomegalovirus CRISPR Clustered regularly interspaced palindromic repeats DNA Deoxyribonucleic acid EDTA Ethylenediaminetetraacetic acid FACS Fluorescence-activated cell sorting FBS Fetal bovine serum FCoV Feline coronavirus FDA United States Food & Drug Administration FECV Feline enteric coronavirus FIP Feline infectious peritonitis FIPV Feline infectious peritonitis virus FIV Feline immunodeficiency virus FVRCP Feline viral rhinotracheitis, calicivirus, and panleukopenia DPBS Dulbecco’s phosphate buffered saline DMEM Dulbecco’s modified Eagle’s medium GMP Good manufacturing practice HIV Human immunodeficiency virus HRP Horseradish peroxidase IBD Inflammatory bowel disease IFN Interferon IL Interleukin IVT In vitro transcribed KO Knockout LNGFR Truncated human nerve growth factor receptor mAb Monoclonal antibody MACS Magnetic-activated cell sorting MHC Major histocompatibility complex MOI Multiplicity of infection NK Natural killer cell NKT Natural killer T cell PES Polyethersulfone PMA/I Phorbol myristate acetate with ionomycin PCR Polymerase chain reaction qPCR Quantitative Polymerase chain reaction RdRp RNA-dependent RNA polymerase rf Recombinant feline xvii rh Recombinant human RNA Ribonucleic acid RPMI Roswell Park Memorial Institute medium RRE Rev response element SARS-CoV-2 Severe acute respiratory syndrome coronavirus 2 ScFv Single-chain variable fragment SLE Systemic lupus erythematosus TALEN Transcription activator-like effector nucleases TBST Tris-buffered saline + 0.1% polyoxyethylene 20 sorbitan monolaurate TCR T cell receptor TGF-b1 Transforming growth factor beta-1 TH1 T Helper 1 cell Treg Regulatory T cell VH Variable heavy chain VL Variable light chain WPRE Woodchuck hepatitis virus post-transcriptional regulatory element WT Wild type 1 CHAPTER 1 Introduction* *Adapted from: Cockey JR and Leifer CA (2023) Racing CARs to veterinary immuno-oncology. Front. Vet. Sci. 10:1130182. doi: 10.3389/fvets.2023.1130182 Author Contributions JRC and CAL conceived of the review, wrote, and edited the manuscript. JRC performed searches in PubMed and Google Scholar databases including, but not limited to: “CAR T therapy,” chimeric antigen receptor,” “canine,” “feline,” “CAR NKT,” “macrophage markers,” ‘T cell phenotype,” “gamma delta T cell veterinary,” “murine T cells.” 2 Abstract Chimeric antigen receptors (CARs) have demonstrated remarkable promise in human oncology over the past two decades, yet similar strategies in veterinary medicine are still in development. CARs are synthetically engineered proteins comprised of a specific antigen-binding single chain variable fragment (ScFv) fused to the signaling domain of a T cell receptor and co-receptors. Patient T cells engineered to express a CAR are directed to recognize and kill target cells, most commonly hematological malignancies. The U.S Food and Drug Administration (FDA) has approved multiple human CAR T therapies for cancer, but translation of these therapies into veterinary medicine faces many challenges. One possible avenue for which CAR T therapy could be explored in veterinary medicine is as an antiviral, particularly for the devastating disease known feline infectious peritonitis (FIP). In this chapter, we discuss considerations for veterinary use including CAR design and cell carrier choice, and discuss the future promise of translating CAR therapy into veterinary medicine for oncology as well as for the potential use as an antiviral to treat FIP. 1.1 Introduction Cell-based immunotherapy has progressed exponentially over the past few decades as a cutting-edge treatment option for multiple cancers. Adoptive cell therapy (ACT) involves harvesting immune cells from the patient, expanding them under good manufacturing practice (GMP) conditions, and reinfusing a clinically relevant dose. 3 One of the first human ACTs used isolated tumor infiltrating lymphocytes (TILs) and selected for cells with a T cell receptor (TCR) specific towards a tumor neoantigen presented on major histocompatibility complex (MHC) I of the tumor.1–3 Although promising,4–6 a significant advance in ACT that takes advantage of the specificity and affinity of antibodies against a tumor surface antigen, rather than relying on endogenous TCRs, is chimeric antigen receptors (CARs). The FDA has approved multiple CAR T therapies against human B cell maturation antigen expressed on antibody-secreting plasma cells 7,8, and CD19, which is expressed on the surface of almost all B cells.9–12 Similar to humans, lymphomas are common in companion animals. Retrospective analysis of 171 canine and feline non-Hodgkin’s lymphoma samples revealed 79.9% of canine cases were B cell lymphomas that were predominantly multicentric, while 64.6% of feline cases were T cell lymphomas that were predominantly alimentary.13 While chemotherapy remains the standard of care in veterinary medicine,14 CARs are an attractive alternative or add on therapy for refractory veterinary lymphomas. Clinical trials have only recently been initiated in dogs. In addition to their use in cancer, CARs may also have use in treating other diseases such as viral infections and autoimmune disorders. Of particular interest to us is feline infectious peritonitis (FIP), a severe disease in cats for which there are currently no FDA-approved therapies. In this chapter, we outline the design of CARs, the clinical and etiological aspects of FIP, and the future outlook of CAR-based cell therapy for veterinary use. 4 1.2 CAR Construct Design Development of a CAR therapy requires multiple steps, each of which presents unique challenges for translation to veterinary medicine (Figure 1.1). In this section, we summarize basic CAR design and methods of expressing the CAR in primary cells. CARs are created by stitching together an ScFv, a hinge, a transmembrane domain, and one or more cytoplasmic signaling domain(s) derived from the TCR signaling complex.15,16 ScFvs are developed from the variable light and heavy chains of a specific monoclonal antibody targeting a tumor-associated antigen. Some CAR approaches use endogenous ligands or receptors, rather than ScFvs, to target tumors and may be a good alternative when cross-reactive or veterinary-specific antibodies are not available.17 Newer high-throughput fluorescence-activated cell sorting (FACS) screens can also be used to identify potential antibodies or ScFvs,18 but it is unclear if this strategy would be practical for clinical manufacturing in veterinary medicine. The cytoplasmic signaling domains are critical to drive T cell activation and can lead to different effector functions in the patient. Use of one signaling domain, CD3z, resulted in low-level signaling, and poor persistence or anergy in patients.19,20 CAR T therapies approved for human use have additional costimulatory receptor signaling domains like 4-1BB (Kymriah®, Breyanzi®, Abecma®, Carvyktiâ, and Aucatzylâ) or CD28 (Yescarta®, Tecartus®). Human primary T cells transduced with a CAR containing the CD28 signaling domain preferentially generated effector memory T cells in vitro (CCR7-CD45RO+) while the 4-1BB signaling domain drove a central 5 memory phenotype (CCR7+CD45RO+).21 Using NSG mice with a xenografted osteosarcoma, infused human CAR T cells with 4-1BB had lower expression of exhaustion markers than those with CD28.22 Some CARs use two costimulatory domains and have increased efficacy in preclinical animal models.23,24 Comparison of efficacy of different CAR components in veterinary oncology remains limited and will likely require additional empirical testing.25 CARs are frequently delivered to patient primary T cells using a replication- incompetent lentivirus or g-retrovirus.26,27 Pre-activation is required because the viruses can only (g-retrovirus), or preferentially (lentivirus), integrate into dividing cells.26,27 However, other approaches have used transposons to integrate the CAR- encoding DNA.28,29 To avoid delivery of viruses to patients, CAR-encoding mRNA has been directly electroporated into human and canine T cells.30,31 However, CD20 CAR expression by mRNA delivery was transient and waned after 14 days in canine T cells.30 Lipid nanoparticles may enhance delivery of CAR mRNA and can be used in vivo.32 Transient CAR expression could be an advantage for veterinary therapy since it will limit immune reaction against the xenogeneic antibody components of the ScFv. Regardless of which CAR is developed, the sequences should be species-matched as much as possible to reduce host anti-CAR immune responses. Gene editing tools such as transcription activator-like effector nucleases (TALENâ) and clustered regularly interspaced palindromic repeats (CRISPR)/Cas9 allow for simultaneous delivery of the CAR and reduced graft-vs-host and host-vs-graft 6 responses.33–36 For example, CAR insertion into the TRAC locus allows for expression of the CAR under the endogenous transcriptional regulation of the TRAC promoter, which limits exhaustion, and elimination of TCR expression, which reduces graft vs. host disease.37 Conversely, deletion of b2-microglobulin, part of MHC I, reduces CAR T cell rejection by the host. However, loss of MHC I increases detection and destruction by natural killer (NK) cells, which can be mitigated in part by knock-in of human leukocyte antigen E into the B2M locus.38 Inhibitory receptors such as PD-1, which limit CAR T cytotoxicity, can also be deleted using these gene editing tools.39 However, CRISPR can induce unwanted mutations,40,41 or multiple donor DNA insertions.42 Unpredicted translocations have also occurred when TALENâ was used to delete the TCR alpha chain and CD52 to make “universal” CAR T cells.35 Fortunately, these off-target events are relatively rare.43 Figure 1.1 Overall scheme for CAR therapy in veterinary medicine. (1) Autologous (from the patient) or allogeneic (from a donor) cells are harvested from peripheral blood or apheresis, (2) enriched and (3) engineered to a express a CAR ex vivo. The CAR contains the variable heavy and light chains of a monoclonal antibody specific for a tumor-associated antigen and signaling domains from the TCR signaling complex. (4) The CAR+ cells are expanded to a clinically relevant dose and (5) infused into the patient. These CAR cells will detect and destroy cells expressing the target antigen. Figure created in BioRender. 7 1.3 Cell Manufacturing While GMP guidelines must be followed for clinical-stage ACT in both human and veterinary medicine, there are some specific considerations for veterinary application. In this section we will outline methods that are under investigation for veterinary CAR T cell expansion, as well as systems employed in human CAR T cell production that could be adapted for veterinary use. Production of cells for clinical use requires validation of standard operating procedures and GMP-grade reagents and materials in all manufacturing steps with individual certificates of analysis. Growth of cells for human medicine requires serum- free, xeno-free, GMP-grade, commercial media formulations. There may not be commercially available GMP-grade species-specific sera for veterinary applications. Anti-canine CD20 CAR T cells failed to grow in OpTmizer ä serum-free media, and while there was some growth in LymphoONEä serum-free media, CAR expression levels were low, suggesting empirical identification of optimal growth conditions for each veterinary CAR application may be necessary.44 Moreover, veterinary species cytokine supplements are limited,45 and thus validated cross-reactive reagents may be required.46 Feeder cells or special additives can enhance ex vivo expansion. For example, K562 cells can be engineered to express human CD32 and canine CD86, thereby acting as artificial antigen presenting cells (aAPCs). Co-culture of canine T cells with these aAPCs resulted in nearly six-fold expansion, and was even able to stimulate proliferation in T cells that were unresponsive to agonistic anti-canine CD3/CD28 beads.30 High CD8+ subset expansion and reduced PD-1/PD-L1 8 expression on canine CAR T cells occurred when the cells were grown with thyroid adenocarcinoma aAPCs expressing CD80, CD83, CD86, and 4-1BBL in the presence of phytohemagglutinin.47 Phytohemagglutinin also increased retroviral transduction efficiency.44 Additional advancements in cell culture using closed-system bioreactors can further enhance ex vivo expansion yield, reduce contamination risks, and minimize technician handling.26,48–52These devices will likely be employed more frequently in future veterinary clinical trials. 1.4 Choosing the “CAR Driver” Currently all FDA approved human CAR therapies are T cell-based, and T cells are also the “driver” for canine CAR therapy. However, many different immune cells could potentially be used to carry a CAR (Table 1.1). In this section, we describe the major advantages and limitations of each cell type, as well as the development and therapeutic potential in veterinary medicine. The focus is on canine CARs since they have advanced the farthest in veterinary medicine, but we will discuss potential use in felines and highlight findings in human medicine that have potential for veterinary applicability. 1.4.1 T cells The most advanced CAR therapeutics in veterinary medicine are T cells. The first clinical trial of CAR T cells in canine patients delivered a CD20 CAR mRNA by electroporation. The CAR contained a murine anti-canine CD20 ScFv with human 9 CD8a leader, hinge, transmembrane, and a CD3z signaling domain.30 One canine patient with relapsed spontaneous B cell lymphoma was infused in three separate doses and had reduced CD20+ cell numbers with no adverse events. A follow up study treated diffuse large B cell lymphoma with anti-CD20 CAR containing the same ScFv, but canine signaling domains.53 No adverse events were documented following infusion in three dogs, but this therapy had lower efficacy and in vivo persistence of the cells was poor. Eventually, an escape-variant of CD20 was detected on peripheral blood B cells post-infusion. Additionally, two of the dogs developed anti-mouse ScFv CAR serum antibodies, which peaked at day 50 post-infusion. These types of anti- CAR immune responses can be reduced by generating a “caninized” ScFv where all but the complementarity determining regions of the ScFv are canine. Preclinical and clinical investigation of canine CAR T cells has also begun to target solid tumors, which have notoriously been resistant in human CAR therapy. A HER2 CAR T cell therapy54 with canine CD28 and CD3z signaling domains secreted IFNg and was cytotoxic against HER2+ osteosarcoma and breast cancer target cell lines in vitro.55 IL13Ra canine CAR T cells secreted IFNg when incubated with IL13Ra+ targets.56 A canine glioma cell line implanted into mouse brains was effectively eliminated using canine CAR T cells against IL13Ra with either a human or a canine 4-1BB signaling domain. B7-H3 CAR T cells57 were more cytotoxic than HER2 CAR T cells towards canine osteosarcoma spheroids, but cytotoxicity was similar for the constructs incorporating CD28 or 4-1BB signaling domains.58 Two healthy canine subjects were then infused with either frozen or fresh autologous B7-H3 CAR T cells. The fresh infusion did induce a grade 2 toxicity, but no other adverse events were 10 observed, while the recipient of frozen cells had an allergic reaction 67 days later that was likely unrelated to the infusion. Together, these results show that canine CAR T cells are safe and well-tolerated, even for some solid tumors. The most notable drawback of human CAR T therapy is cytokine release syndrome, which presents with pyrexia, delirium, hypotension, and increased serum IL6, and often requires administration of the IL6 receptor antagonist tocilizumab and steroids.59 To enhance safety and rapidly deplete infused cells in the event of an adverse reaction, drug-sensitive “kill switches” can be incorporated into the CAR.60–64 Since some adverse reactions have been observed in canine CAR T trials, including a case report of increased serum cytokines consistent with cytokine release syndrome,65 incorporating kill switches in the CAR construct may be needed in veterinary medicine as well. Table 1.1 Summary of species-specific surface markers that define immune cells and can be used to enrich desired populations through FACS or magnetic bead enrichment. .Immune cell Human phenotypic markers Murine phenotypic markers Canine phenotypic markers Feline phenotypic markers Ref T cell CD3+CD56- abTCR+ CD3+ abTCR+NK1.1- CD3+CD5bright NKp46- abTCR+ CD3+CD56- abTCR+ 66–70 11 1.4.2 Natural killer cells NK cells have reduced risk of inducing a graft vs host response and have shown promise in human preclinical studies. Moreover, human NK cells can be sourced allogeneically,91,92 and infused at higher doses.93,94 Allogeneic sourcing may allow mass production of an “off the shelf” product, reducing manufacturing costs, which is a significant concern in veterinary medicine. NK cell CD3-CD56+CD7+ CD3- NK1.1+ abTCR- CD3-/+ CD5dimCD8+T CRab-TCRgd- CD21-CD4- CD94+ NKp46+ CD3-CD56+ 66,71–77 NKT cell CD3+CD56+/- iTCR+ CD3+NK1.1+ iTCR+ CD3+CD5interm ediate NKp46+CD94+ iTCR+ CD3+CD56+ 66,71,72, 74,78–80 gd T cell CD3+gdTCR+ CD3+gdTCR+ CD3+gdTCR+ CD3+gdTCR+ 81–84 Macrophage CD68+: CD80+CD206dim (M1) or CD80-CD206bright (M2) F4/80+: CD38+ (M1) or CD38- (M2) Iba1+: CD204- (M1) or CD204+ (M2) Iba1+: CD204-(M1) or CD204+(M2) 85–90 12 Major challenges to using NK cells for veterinary CAR therapy include the lack of consensus on surface markers, limited antibody reagents, and lack of robust purification and expansion protocols. Feline NK cells are CD56+CD3- 71,72 and feline CD3 and CD56 antibodies exist (clones NZM1 and SZK1, respectively).95,96 However, there is not a consensus on canine NK markers. NKp46 is a common NK marker across species and CD3-NKp46+ cells enriched by FACS from canine peripheral blood mononuclear cells (PBMCs) exhibited cytotoxicity towards canine osteosarcoma and canine thyroid adenocarcinoma targets.73 Coculture of canine PBMCs with K562 cells expressing membrane bound IL15 and 4-1BBL, and added human IL2 and IL15, expanded large granular lymphocytes with cytotoxic activity.74 These presumptive NK cells were CD5dimCD3+CD8+TCRab-TCRgd-CD21-CD4- and although they did not have mRNA for CD56, they did have mRNAs for other NK receptors like NKG2D, NKp30, and NKp46. CD5 depleted canine PBMCs cultured with IL2 alone or IL2 and IL15 for 14 days also had NK-like cytotoxicity yet were CD56-.97 CD94+ cells enriched from canine PBMCs were CD5dimNKp46+CD3-.66 A first-in-canine clinical trial infused expanded cells with a similar phenotype into ten sarcoma patients in combination with intratumoral rhIL2 following focal radiotherapy.98 Five of the patients remained metastasis free at the six-month primary endpoint.98 Despite NK cells being safe,99 their clinical efficacy does not yet match CAR T. Moreover, NK cells have a shorter in vivo lifespan than T cells. Addition of the IL15 gene may provide sufficient signaling to overcome these limitations.100,101 13 1.4.3 Other cells Immune cells such as natural killer T (NKT) cells, gd T cells, and macrophages have been explored preclinically and clinically as human CAR drivers (Figure 1.2). Human NKT cells are rare CD3+ lymphocytes expressing an invariant ab TCR, and may co- express CD56.78,102,103 Feline NKT cells are CD56+CD3+;71,72 however, canine NKT markers are more controversial. Originally defined as CD3+ lymphocytes that bound to complexes of a-galactosylceramide and murine CD1d,104 one group identified a CD5intermediateNKp46+CD94+CD3+ subset of large granular lymphocytes that may be NKT cells 66. Clinical isolation protocols for NKT cells may require dual CD56/CD3 enrichment for felines or NKp46/CD3 for canines, and there are currently no expansion protocols to obtain clinically useful numbers of these feline or canine cells. Regardless, human CD19 CAR NKT cells against lymphoma105 and GD2 CAR NKT cells against neuroblastoma106 have demonstrated preclinical efficacy, with CD19 CAR NKT cells exerting anti-lymphoma activity through both the CAR and the invariant TCR interaction with CD1d. However, not all tumors express CD1d and much of the activity will be via the CAR.107,108 Human GD2 CAR NKT cells, co- expressing IL15, infused in pediatric neuroblastoma patients, were well-tolerated and reduced metastasis in one patient. This study provided safety data for human CAR 14 NKT cells co-expressing self-supporting growth factors.109 NKT cells may soon be explored for CAR therapy in veterinary medicine. Figure 1.2 Alternative immune cells besides T cells that have been investigated as “CAR Drivers” in cancer immunotherapy. BTN3A1= butyrophilin subfamily 3 member A1; CAR= chimeric antigen receptor; DNAM-1= DNAX accessory molecule-1; DAP10= MIC A/B= major histocompatibility complex class I chain-related A and B; NKG2D= natural killer group 2 member D; TAA= tumor-associated antigen; TCR= T cell receptor. Figure generated in BioRender. In veterinary medicine, gd T cells play an important role in mucosal immunity,110 and can comprise nearly half of the PBMC compartment in young ruminants.111 gd T cells express TCRs with broad specificity and are MHC independent, yet they have in vitro cytotoxic activity similar to NK and T cells. Human GD2 CAR gd T cells demonstrated in vitro cytotoxicity to the LAN1 neuroblastoma cell line.112 Both canine and feline TCRG loci have been identified and subsets can be classified through PCR, but robust isolation and expansion protocols are lacking.82,83,113 Moreover, many gd T 15 cells are located in peripheral tissues and may be difficult to enrich from peripheral blood in sufficient numbers to expand for clinical use.114 Enrichment of human Vd1 cells from peripheral blood and expansion in cell culture bags using IFNg, anti-CD3, and IL4, for two weeks followed by IL15 for one week, did generate a clinically relevant product yield and upregulation of effector markers (NKG2D, DNAM-1, NKp30, NKp44, and 2B4).115 However, further research is needed to determine if gd T cells will be useful in veterinary CAR therapy. Macrophages are abundant in tumors of many different species, can exhibit anti-tumor activity, and have therapeutic potential as CAR drivers.116,117 Macrophages can polarize to many different functional states from the extremes of proinflammatory M1 to anti-inflammatory/immunosuppressive M2 cells. Tumor-associated macrophages also adapt to the tumor microenvironment in ways that promote rather than eliminate tumors.118 In dogs, high numbers of macrophages in tumors is correlated with increased aggressiveness and worse prognosis for mammary cancer.86 Human THP-1 monocytic cells engineered to express CD19, HER2, or mesothelin CARs, phagocytosed target cells in vitro.119 Primary human HER2 CAR macrophages extended survival in a mouse ovarian xenograft model, suggesting that they still demonstrated antitumor activity despite the immunosuppressive tumor microenvironment.119 Macrophage immunotherapy in veterinary oncology has largely focused on in vivo activation of macrophages rather than ex vivo manipulation and reinfusion, but there is potential to develop them as CAR drivers.120–123 A limitation is that macrophages, and their precursor monocytes, are notoriously difficult to 16 genetically modify regardless of species. Some approaches to overcome this limitation include using a replication-incompetent adenovirus.119,124 Despite their limitations, macrophages and other CAR drivers warrant a basic science investigation to understand their true potential for use in veterinary medicine. 1.5 Applications beyond cancer Although cell-based immunotherapy involving CARs has largely been focused on treating cancer, recently there has been a growing interest in repurposing the modality for other diseases such as autoimmune disorders and viral infections.125 In human medicine, this has included clinically repurposing CD19 CAR T cells to clear autoreactive B cells in patients with systemic lupus erythematosus (SLE),126,127 as well as generating CAR+ cells to combat chronic viral infections such human immunodeficiency virus (HIV), hepatitis C, and severe acute respiratory syndrome coronavirus-2.128–132 Some of these diseases have analogous conditions in domestic species that could benefit from a cell-based immunotherapy approach, as well. Dogs can also suffer from SLE and display a disease state similar to humans, thus using anti-canine CD20 CAR T cells may provide a more effective treatment modality compared to immunosuppressive/immunomodulatory agents.133,134 In cats, feline immunodeficiency virus (FIV), the analog of HIV, similarly results in chronic immunosuppression just as HIV causes acquired immune deficiency syndrome in humans. However, where HIV uses CD4 as its primary entry receptor, FIV uses CD134 as its primary receptor and thus has broader tropism.135 Therefore, instead of using CD4 CAR T cells as have been generated preclinically for HIV,130feline CD134 17 CAR+ cells could be generated against FIV. This strategy would come with the caveat of needing to block or knockout co-receptor expression in the CAR+ cells during the manufacturing process, otherwise they could be susceptible to FIV infection themselves and potentially promote viral dissemination. Another disease of high importance in cats is caused by infection with FIP virus (FIPV), which results in the disease known as FIP. 1.6 Feline Coronavirus Feline coronavirus (FCoV) is a ubiquitous, enveloped single-stranded RNA virus belonging to the genus Alphacoronavirus, and consists of four structural proteins (matrix, nucleocapsid, envelope, and spike), as well as seven non-structural proteins.136 Of the structural proteins, spike is the most well-studied as it is responsible for host receptor binding and cell entry. The spike protein consists of a receptor binding domain, or S1 region, as well as a fusion domain, or S2. The structure of the spike proteins is used to classify the virus into two serotypes, Type I and Type II. The Type I serotype is characterized by both S1/S2 and S2’ cleavage sites and accounts for the majority of clinical cases, but does not propagate well in cell culture, while the Type II serotype makes up a minority of clinical cases but is readily cell cultured adapted, particularly the WSU 79-1683 and 79-1146 strains, and contains only the S2’ cleavage site.137 Type I is believed to be the original FCoV, whereas Type II likely arose from a recombination event between FCoV and canine coronavirus.138 The host receptor for Type II is aminopeptidase N,139 but the Type I receptor remains unknown. Antibody-dependent enhancement (ADE) is a key mechanism for viral spread in vitro 18 and in vivo,140–143 This process can occur through a non-neutralizing or sub- neutralizing titer of antibody bound to virus that then engages the Fc receptor on phagocytes to induce endocytosis. Endosomal acidification then allows the virus to escape the endosome and infect the cell.141 For other viruses, afucosylated immunoglobulin G antibodies may contribute to ADE due to increased affinity of the Fc portion for FcgRIIIa.144 FCoV is also categorized into two biotypes based on pathogenicity and tropism, defined in part by the structure of the spike protein. The virus is normally spreads fecal-orally in the more benign form known as feline enteric coronavirus (FECV), which has tropism for enterocytes and is generally limited to mild enteritis. In approximately 5% of infected cats,145 the spike gene undergoes mutation events around the cleavage sites resulting in development of the pathogenic biotype FIPV. FIPV acquires a tropism for monocytes and macrophages and disseminates systemically. This results in the severe disease known as FIP. While the current paradigm is that FECV mutates into FIPV within a host to then cause FIP, there have been reports of “FIP outbreaks,” suggesting that alternative mechanisms may occur. Morbidity upwards of 90%, and 60% mortality, due to FIP was reported in a cheetah- breeding facility between 1982-1987 suggesting animal-to-animal spread.146 More recently, an outbreak of a novel Type II strain, FCoV-23, has been reported in Cyprus.147 It is, however, possible that there was a genetic component amongst these populations that made them more predisposed to developing FIP following virus 19 mutation rather than direct transmission of FIPV, especially in the case of captive cheetahs.148 1.7 Clinical FIP Despite its original documentation by Dr. Jean Holzworth in the early 1960s,149 FIP still remains one of the most devastating diseases afflicting domestic cats. Although cats of any age are susceptible, it is much more prevalent in younger cats and is the leading cause of death in cats less than two years old.145,150 FIP is characterized by a broad range of systemic symptoms but has been canonically classified into two presentations: wet (effusive) and dry (non-effusive). In the effusive form of the disease, the hallmark symptom for which the disease was named is the polyserositis most often recognized for the ascites accumulation within the abdominal cavity. This is in part due to vasculitis, which is accompanied by pyogranulomatous lesions and fibrin deposition observed in multiple organs upon necropsy.151 In the non-effusive form of the disease, cats often present with neurological symptoms such as ataxia and seizures, and some cats test positive for FCoV antigen in their cerebrospinal fluid.152 Cats with the non-effusive form are also more likely to display ocular symptoms such as uveitis and retinal detachment.153 Although the disease is classified into the two forms, they represent more of a spectrum of clinical presentation rather than a binary distribution. A key factor in determining the disease course is cell-mediated immunity, where cats with limited cell-mediated immunity often present in the effusive form while the non-effusive form may represent an intermediate disease state due to partial cell-mediated control of the infection.151,154 Indeed, activated T cells cultured in ascitic 20 fluid from infected cats undergo apoptosis,155 and both NK and regulatory T cell numbers from cats with FIP are diminished with dampened effector function observed in these NK cells.69 This indicates that aside from directly infecting monocytes and macrophages, FIPV induces other immunosuppressive effects that limit cell-mediated immunity and thus prevent the host from clearing the infection. FIP can be challenging to diagnose due to the lack of a definitive antemortem diagnostic test for all possible FIP presentations, and thus requires consideration for clinical presentation in addition to ruling out other likely differentials. Fever that is unresponsive to antibiotics, inappetence, lethargy, lymphopenia, and increased total protein with decreased albumin/globulin ratio are some of the common telltale signs that a cat may have FIP, though these could apply to other diseases as well.156 A positive Rivalta test run on effusion does not definitively indicate FIP, but a negative test almost always rules it out.156,157 Reverse-transcription polymerase chain reaction for FCoV has been described, but does not distinguish between FECV and pathogenic FIPV.158,159 In cats with effusive FIP, immunofluorescence staining of macrophages in the effusion for intracellular FCoV antigen can be considered a conclusive diagnosis if positive, but a negative result does not rule out FIP as there may not be enough macrophages, or enough infected macrophages, present on the effusion smear.160 Positive immunohistochemistry of multiple organs is often used for conclusive postmortem diagnosis, and could be used on biopsied tissues of non-effusive patients but may require invasive surgical procedures for biopsy collection, and cannot rule out FIP if negative due to low sensitivity.156,158 Thus, new diagnostics are still needed. 21 Effective vaccination for FIP remains difficult. Original FIP vaccination attempts failed to confer sufficient protection and in some cases accelerated disease course, likely due to ADE.151,161 Currently there is a marketed FIP vaccine using a temperature-sensitive mutant version of strain 79-1146 (known as FIPV-DF2), that while safe has questionable efficacy.151,162 Moreover, because it has to be administered after 16 weeks of age, by which point most cats in multi-cat environments have already been exposed to the virus, its use is not practical.151 Until recently this disease was considered invariably fatal, but the new position of the FDA regarding prescription of the nucleoside analog GS-441524163 has given veterinarians a treatment option that results in dramatic clinical responses in client-owned animals.164– 166 Still, there are many cats that do not respond to this drug or relapse after discontinuing the course, requiring second and potentially third courses of treatment.167,168 Thus, an alternative treatment modality such as cell-based immunotherapy could fill this need for that subset of patients. Multiple reports have demonstrated that the spike protein of the virus, present on the outer surface of the virion and responsible for receptor binding for cell entry, is also expressed on the surface of infected cells in vitro and can induce syncytia formation.169,170 Although one report claimed that spike was not found to be present on the surface of cells extracted from granulomas and exudates of cats with FIP, this study also reported that approximately only 1-10% of those total cells were actually FIPV+, calling into question the sensitivity of detecting viral surface antigens in such a 22 relatively small population.171 Therefore, designing a CAR towards the FIPV spike protein could serve as an effective therapeutic strategy to specifically target virally infected cells. 1.8 Discussion Cell-based immunotherapy has gained traction as a promising therapeutic modality for multiple cancers in both human and veterinary patients. Although clinical veterinary studies are still in the beginning phases, the potential for breakthrough therapies, like has happened for human hematologic oncology, is high. Veterinary clinical trials involving infusions of T cells and NK cells in dogs have demonstrated the feasibility and safety of harvesting and manufacturing cells for clinical use.30,53,58,98 Therefore, advancing this treatment modality towards use as an antiviral for disease such as FIP should be streamlined. Using this approach to target the spike protein of FIPV, in this thesis we were able to demonstrate a proof of concept for a CAR cell therapy against FIP. However, to fully break into the cellular immunotherapy sector the way human medicine has, veterinary schools or other hospitals will need appropriate infrastructure for cellular manufacturing and genetic modification or identify industry partners. Current manufacturing systems are designed for clinical production of human cellular therapeutics, but as interest in veterinary cell therapy grows, so will the market for xeno-free GMP-grade media, reagents, and supplements to be used for species- specific cell isolation and clinical expansion. The potential cost of the therapy also presents a major hurdle, and possibly the biggest challenge towards translation to clinical veterinary use. Insurance coverages that can defray the 6-figure prices of 23 human CAR T cell therapies would not be an option in veterinary medicine. Thus, a significant focus of future veterinary CAR research must be to develop more generally tolerable therapies with low levels of side effects to create a product that could be administered at a general veterinary practice. These will likely include a product where endogenous TCRs are deleted, and other modifications are made to reduce cytokine release syndrome. Overall, companion animal patients may similarly benefit from immunotherapies as human patients have because they share both the environment and the spontaneous development of disease. In the spirit of one health, as the field progresses in veterinary medicine, future treatment modalities designed for companion animals may one day translate back to human medicine. 24 REFERENCES 1. Deniger DC, Pasetto A, Tran E, et al. Stable, Nonviral Expression of Mutated Tumor Neoantigen-specific T-cell Receptors Using the Sleeping Beauty Transposon/Transposase System. Molecular Therapy. 2016;24(6):1078-1089. doi:10.1038/mt.2016.51 2. Jin J, Sabatino M, Somerville R, et al. Simplified Method of the Growth of Human Tumor Infiltrating Lymphocytes in Gas-permeable Flasks to Numbers Needed for Patient Treatment: Journal of Immunotherapy. 2012;35(3):283-292. doi:10.1097/CJI.0b013e31824e801f 3. Dudley ME, Wunderlich JR, Shelton TE, Even J, Rosenberg SA. Generation of tumor-infiltrating lymphocyte cultures for use in adoptive transfer therapy for melanoma patients. J Immunother. 2003;26(4):332-342. doi:10.1097/00002371- 200307000-00005 4. Zacharakis N, Chinnasamy H, Black M, et al. Immune recognition of somatic mutations leading to complete durable regression in metastatic breast cancer. Nat Med. 2018;24(6):724-730. doi:10.1038/s41591-018-0040-8 5. Rosenberg SA, Yang JC, Sherry RM, et al. Durable Complete Responses in Heavily Pretreated Patients with Metastatic Melanoma Using T-Cell Transfer Immunotherapy. Clinical Cancer Research. 2011;17(13):4550-4557. doi:10.1158/1078-0432.CCR-11-0116 25 6. Dudley ME. Cancer Regression and Autoimmunity in Patients After Clonal Repopulation with Antitumor Lymphocytes. Science. 2002;298(5594):850-854. doi:10.1126/science.1076514 7. Berdeja JG, Madduri D, Usmani SZ, et al. Ciltacabtagene autoleucel, a B-cell maturation antigen-directed chimeric antigen receptor T-cell therapy in patients with relapsed or refractory multiple myeloma (CARTITUDE-1): a phase 1b/2 open-label study. The Lancet. 2021;398(10297):314-324. doi:10.1016/S0140- 6736(21)00933-8 8. Raje N, Berdeja J, Lin Y, et al. Anti-BCMA CAR T-Cell Therapy bb2121 in Relapsed or Refractory Multiple Myeloma. N Engl J Med. 2019;380(18):1726- 1737. doi:10.1056/NEJMoa1817226 9. Shah BD, Bishop MR, Oluwole OO, et al. KTE-X19 anti-CD19 CAR T-cell therapy in adult relapsed/refractory acute lymphoblastic leukemia: ZUMA-3 phase 1 results. Blood. 2021;138(1):11-22. doi:10.1182/blood.2020009098 10. Abramson JS, Palomba ML, Gordon LI, et al. Lisocabtagene maraleucel for patients with relapsed or refractory large B-cell lymphomas (TRANSCEND NHL 001): a multicentre seamless design study. The Lancet. 2020;396(10254):839-852. doi:10.1016/S0140-6736(20)31366-0 11. Maude SL, Laetsch TW, Buechner J, et al. Tisagenlecleucel in Children and Young Adults with B-Cell Lymphoblastic Leukemia. N Engl J Med. 2018;378(5):439-448. doi:10.1056/NEJMoa1709866 26 12. Neelapu SS, Locke FL, Bartlett NL, et al. Axicabtagene Ciloleucel CAR T-Cell Therapy in Refractory Large B-Cell Lymphoma. N Engl J Med. 2017;377(26):2531-2544. doi:10.1056/NEJMoa1707447 13. Vezzali E, Parodi AL, Marcato PS, Bettini G. Histopathologic classification of 171 cases of canine and feline non-Hodgkin lymphoma according to the WHO. Veterinary and Comparative Oncology. 2010;8(1):38-49. doi:10.1111/j.1476- 5829.2009.00201.x 14. Richards KL, Suter SE. Man’s best friend: what can pet dogs teach us about non- Hodgkin’s lymphoma? Immunol Rev. 2015;263(1):173-191. doi:10.1111/imr.12238 15. Jackson HJ, Rafiq S, Brentjens RJ. Driving CAR T-cells forward. Nat Rev Clin Oncol. 2016;13(6):370-383. doi:10.1038/nrclinonc.2016.36 16. Sadelain M, Brentjens R, Rivière I. The basic principles of chimeric antigen receptor design. Cancer Discov. 2013;3(4):388-398. doi:10.1158/2159-8290.CD- 12-0548 17. Branella GM, Spencer HT. Natural Receptor- and Ligand-Based Chimeric Antigen Receptors: Strategies Using Natural Ligands and Receptors for Targeted Cell Killing. Cells. 2021;11(1):21. doi:10.3390/cells11010021 18. Fierle JK, Abram-Saliba J, Atsaves V, et al. A cell-based phenotypic library selection and screening approach for the de novo discovery of novel functional 27 chimeric antigen receptors. Sci Rep. 2022;12(1):1136. doi:10.1038/s41598-022- 05058-5 19. Jensen MC, Popplewell L, Cooper LJ, et al. Antitransgene Rejection Responses Contribute to Attenuated Persistence of Adoptively Transferred CD20/CD19- Specific Chimeric Antigen Receptor Redirected T Cells in Humans. Biology of Blood and Marrow Transplantation. 2010;16(9):1245-1256. doi:10.1016/j.bbmt.2010.03.014 20. Till BG, Jensen MC, Wang J, et al. Adoptive immunotherapy for indolent non- Hodgkin lymphoma and mantle cell lymphoma using genetically modified autologous CD20-specific T cells. Blood. 2008;112(6):2261-2271. doi:10.1182/blood-2007-12-128843 21. Kawalekar OU, O’Connor RS, Fraietta JA, et al. Distinct Signaling of Coreceptors Regulates Specific Metabolism Pathways and Impacts Memory Development in CAR T Cells. Immunity. 2016;44(2):380-390. doi:10.1016/j.immuni.2016.01.021 22. Long AH, Haso WM, Shern JF, et al. 4-1BB costimulation ameliorates T cell exhaustion induced by tonic signaling of chimeric antigen receptors. Nat Med. 2015;21(6):581-590. doi:10.1038/nm.3838 23. Zhong XS, Matsushita M, Plotkin J, Riviere I, Sadelain M. Chimeric Antigen Receptors Combining 4-1BB and CD28 Signaling Domains Augment 28 PI3kinase/AKT/Bcl-XL Activation and CD8+ T Cell–mediated Tumor Eradication. Molecular Therapy. 2010;18(2):413-420. doi:10.1038/mt.2009.210 24. Wang J, Jensen M, Lin Y, et al. Optimizing Adoptive Polyclonal T Cell Immunotherapy of Lymphomas, Using a Chimeric T Cell Receptor Possessing CD28 and CD137 Costimulatory Domains. Human Gene Therapy. 2007;18(8):712-725. doi:10.1089/hum.2007.028 25. Mochel JP, Ekker SC, Johannes CM, et al. CAR T Cell Immunotherapy in Human and Veterinary Oncology: Changing the Odds Against Hematological Malignancies. AAPS J. 2019;21(3):50. doi:10.1208/s12248-019-0322-1 26. Levine BL, Miskin J, Wonnacott K, Keir C. Global Manufacturing of CAR T Cell Therapy. Molecular Therapy - Methods & Clinical Development. 2017;4:92- 101. doi:10.1016/j.omtm.2016.12.006 27. Levine BL. Performance-enhancing drugs: design and production of redirected chimeric antigen receptor (CAR) T cells. Cancer Gene Ther. 2015;22(2):79-84. doi:10.1038/cgt.2015.5 28. Guedan S, Calderon H, Posey AD, Maus MV. Engineering and Design of Chimeric Antigen Receptors. Molecular Therapy - Methods & Clinical Development. 2019;12:145-156. doi:10.1016/j.omtm.2018.12.009 29. Huang X, Guo H, Kang J, et al. Sleeping Beauty Transposon‐mediated Engineering of Human Primary T Cells for Therapy of CD19+ Lymphoid 29 Malignancies. Molecular Therapy. 2008;16(3):580-589. doi:10.1038/sj.mt.6300404 30. Panjwani MK, Smith JB, Schutsky K, et al. Feasibility and Safety of RNA- transfected CD20-specific Chimeric Antigen Receptor T Cells in Dogs with Spontaneous B Cell Lymphoma. Mol Ther. 2016;24(9):1602-1614. doi:10.1038/mt.2016.146 31. Beatty GL, Haas AR, Maus MV, et al. Mesothelin-Specific Chimeric Antigen Receptor mRNA-Engineered T Cells Induce Antitumor Activity in Solid Malignancies. Cancer Immunology Research. 2014;2(2):112-120. doi:10.1158/2326-6066.CIR-13-0170 32. Rurik JG, Tombácz I, Yadegari A, et al. CAR T cells produced in vivo to treat cardiac injury. Science. 2022;375(6576):91-96. doi:10.1126/science.abm0594 33. Sugita M, Galetto R, Zong H, et al. Allogeneic TCRαβ deficient CAR T-cells targeting CD123 in acute myeloid leukemia. Nat Commun. 2022;13(1):2227. doi:10.1038/s41467-022-29668-9 34. Georgiadis C, Preece R, Nickolay L, et al. Long Terminal Repeat CRISPR-CAR- Coupled “Universal” T Cells Mediate Potent Anti-leukemic Effects. Molecular Therapy. 2018;26(5):1215-1227. doi:10.1016/j.ymthe.2018.02.025 30 35. Qasim W, Zhan H, Samarasinghe S, et al. Molecular remission of infant B-ALL after infusion of universal TALEN gene-edited CAR T cells. Sci Transl Med. 2017;9(374):eaaj2013. doi:10.1126/scitranslmed.aaj2013 36. Poirot L, Philip B, Schiffer-Mannioui C, et al. Multiplex Genome-Edited T-cell Manufacturing Platform for “Off-the-Shelf” Adoptive T-cell Immunotherapies. Cancer Res. 2015;75(18):3853-3864. doi:10.1158/0008-5472.CAN-14-3321 37. Eyquem J, Mansilla-Soto J, Giavridis T, et al. Targeting a CAR to the TRAC locus with CRISPR/Cas9 enhances tumour rejection. Nature. 2017;543(7643):113-117. doi:10.1038/nature21405 38. Jo S, Das S, Williams A, et al. Endowing universal CAR T-cell with immune- evasive properties using TALEN-gene editing. Nat Commun. 2022;13(1):3453. doi:10.1038/s41467-022-30896-2 39. Ren J, Liu X, Fang C, Jiang S, June CH, Zhao Y. Multiplex Genome Editing to Generate Universal CAR T Cells Resistant to PD1 Inhibition. Clin Cancer Res. 2017;23(9):2255-2266. doi:10.1158/1078-0432.CCR-16-1300 40. Alanis-Lobato G, Zohren J, McCarthy A, et al. Frequent loss of heterozygosity in CRISPR-Cas9–edited early human embryos. Proc Natl Acad Sci USA. 2021;118(22):e2004832117. doi:10.1073/pnas.2004832117 31 41. Zuccaro MV, Xu J, Mitchell C, et al. Allele-Specific Chromosome Removal after Cas9 Cleavage in Human Embryos. Cell. 2020;183(6):1650-1664.e15. doi:10.1016/j.cell.2020.10.025 42. Skryabin BV, Kummerfeld DM, Gubar L, et al. Pervasive head-to-tail insertions of DNA templates mask desired CRISPR-Cas9–mediated genome editing events. Sci Adv. 2020;6(7):eaax2941. doi:10.1126/sciadv.aax2941 43. Ottaviano G, Georgiadis C, Gkazi SA, et al. Phase 1 clinical trial of CRISPR- engineered CAR19 universal T cells for treatment of children with refractory B cell leukemia. Sci Transl Med. 2022;14(668):eabq3010. doi:10.1126/scitranslmed.abq3010 44. Sakai O, Yamamoto H, Igase M, Mizuno T. Optimization of Culture Conditions for the Generation of Canine CD20-CAR-T Cells for Adoptive Immunotherapy. In Vivo. 2022;36(2):764-772. doi:10.21873/invivo.12763 45. Addissie S, Klingemann H. Cellular Immunotherapy of Canine Cancer. Veterinary Sciences. 2018;5(4):100. doi:10.3390/vetsci5040100 46. Rotolo A, Atherton MJ, Kasper BT, Haran KP, Mason NJ. Genetic re-direction of canine primary T cells for clinical trial use in pet dogs with spontaneous cancer. STAR Protocols. 2021;2(4):100905. doi:10.1016/j.xpro.2021.100905 32 47. Sakai O, Igase M, Mizuno T. Optimization of canine CD20 chimeric antigen receptor T cell manufacturing and in vitro cytotoxic activity against B‐cell lymphoma. Vet Comp Oncol. 2020;18(4):739-752. doi:10.1111/vco.12602 48. Gagliardi C, Khalil M, Foster AE. Streamlined production of genetically modified T cells with activation, transduction and expansion in closed-system G- Rex bioreactors. Cytotherapy. 2019;21(12):1246-1257. doi:10.1016/j.jcyt.2019.10.006 49. Davis BM, Loghin ER, Conway KR, Zhang X. Automated Closed-System Expansion of Pluripotent Stem Cell Aggregates in a Rocking-Motion Bioreactor. SLAS Technology. 2018;23(4):364-373. doi:10.1177/2472630318760745 50. Gee AP. GMP CAR-T cell production. Best Practice & Research Clinical Haematology. 2018;31(2):126-134. doi:10.1016/j.beha.2018.01.002 51. Fraser AR, Pass C, Burgoyne P, et al. Development, functional characterization and validation of methodology for GMP-compliant manufacture of phagocytic macrophages: A novel cellular therapeutic for liver cirrhosis. Cytotherapy. 2017;19(9):1113-1124. doi:10.1016/j.jcyt.2017.05.009 52. Granzin M, Soltenborn S, Müller S, et al. Fully automated expansion and activation of clinical-grade natural killer cells for adoptive immunotherapy. Cytotherapy. 2015;17(5):621-632. doi:10.1016/j.jcyt.2015.03.611 33 53. Panjwani MK, Atherton MJ, MaloneyHuss MA, et al. Establishing a model system for evaluating CAR T cell therapy using dogs with spontaneous diffuse large B cell lymphoma. Oncoimmunology. 2020;9(1):1676615. doi:10.1080/2162402X.2019.1676615 54. Wels W, Harwerth IM, Zwickl M, Hardman N, Groner B, Hynes NE. Construction, Bacterial Expression and Characterization of a Bifunctional Single–Chain Antibody–Phosphatase Fusion Protein Targeted to the Human ERBB–2 Receptor. Nat Biotechnol. 1992;10(10):1128-1132. doi:10.1038/nbt1092-1128 55. Mata M, Vera JF, Gerken C, et al. Toward Immunotherapy With Redirected T Cells in a Large Animal Model: Ex Vivo Activation, Expansion, and Genetic Modification of Canine T Cells. Journal of Immunotherapy. 2014;37(8):407-415. doi:10.1097/CJI.0000000000000052 56. Yin Y, Boesteanu AC, Binder ZA, et al. Checkpoint Blockade Reverses Anergy in IL-13Rα2 Humanized scFv-Based CAR T Cells to Treat Murine and Canine Gliomas. Molecular Therapy - Oncolytics. 2018;11:20-38. doi:10.1016/j.omto.2018.08.002 57. Loo D, Alderson RF, Chen FZ, et al. Development of an Fc-Enhanced Anti–B7- H3 Monoclonal Antibody with Potent Antitumor Activity. Clin Cancer Res. 2012;18(14):3834-3845. doi:10.1158/1078-0432.CCR-12-0715 34 58. Zhang S, Black RG, Kohli K, et al. B7-H3 Specific CAR T Cells for the Naturally Occurring, Spontaneous Canine Sarcoma Model. Molecular Cancer Therapeutics. 2022;21(6):999-1009. doi:10.1158/1535-7163.MCT-21-0726 59. Davila ML, Riviere I, Wang X, et al. Efficacy and toxicity management of 19- 28z CAR T cell therapy in B cell acute lymphoblastic leukemia. Sci Transl Med. 2014;6(224):224ra25. doi:10.1126/scitranslmed.3008226 60. Di Stasi A, Tey SK, Dotti G, et al. Inducible apoptosis as a safety switch for adoptive cell therapy. N Engl J Med. 2011;365(18):1673-1683. doi:10.1056/NEJMoa1106152 61. Hoyos V, Savoldo B, Quintarelli C, et al. Engineering CD19-specific T lymphocytes with interleukin-15 and a suicide gene to enhance their anti- lymphoma/leukemia effects and safety. Leukemia. 2010;24(6):1160-1170. doi:10.1038/leu.2010.75 62. Straathof KC, Pulè MA, Yotnda P, et al. An inducible caspase 9 safety switch for T-cell therapy. Blood. 2005;105(11):4247-4254. doi:10.1182/blood-2004-11- 4564 63. Rivas C, Miller AR, Collado M, Lam EW, Apperley JF, Melo JV. BCR-ABL- expressing cells transduced with the HSV-tk gene die by apoptosis upon treatment with ganciclovir. Mol Ther. 2001;3(5 Pt 1):642-652. doi:10.1006/mthe.2001.0310 35 64. Frank KB, Chiou JF, Cheng YC. Interaction of herpes simplex virus-induced DNA polymerase with 9-(1,3-dihydroxy-2-propoxymethyl)guanine triphosphate. J Biol Chem. 1984;259(3):1566-1569. 65. Atherton MJ, Rotolo A, Haran KP, Mason NJ. Case Report: Clinical and Serological Hallmarks of Cytokine Release Syndrome in a Canine B Cell Lymphoma Patient Treated With Autologous CAR-T Cells. Front Vet Sci. 2022;9:824982. doi:10.3389/fvets.2022.824982 66. Graves SS, Gyurkocza B, Stone DM, et al. Development and characterization of a canine-specific anti-CD94 (KLRD-1) monoclonal antibody. Veterinary Immunology and Immunopathology. 2019;211:10-18. doi:10.1016/j.vetimm.2019.03.005 67. Comazzi S, Riondato F. Flow Cytometry in the Diagnosis of Canine T-Cell Lymphoma. Front Vet Sci. 2021;8:600963. doi:10.3389/fvets.2021.600963 68. Radtanakatikanon A, Keller SM, Darzentas N, et al. Topology and expressed repertoire of the Felis catus T cell receptor loci. BMC Genomics. 2020;21(1):20. doi:10.1186/s12864-019-6431-5 69. Vermeulen BL, Devriendt B, Olyslaegers DA, et al. Suppression of NK cells and regulatory T lymphocytes in cats naturally infected with feline infectious peritonitis virus. Vet Microbiol. 2013;164(1-2):46-59. doi:10.1016/j.vetmic.2013.01.042 36 70. Glusman G, Rowen L, Lee I, et al. Comparative Genomics of the Human and Mouse T Cell Receptor Loci. Immunity. 2001;15(3):337-349. doi:10.1016/S1074-7613(01)00200-X 71. Vermeulen BL, Devriendt B, Olyslaegers DA, et al. Natural killer cells: frequency, phenotype and function in healthy cats. Vet Immunol Immunopathol. 2012;150(1-2):69-78. doi:10.1016/j.vetimm.2012.08.010 72. Simões RD, Howard KE, Dean GA. In Vivo Assessment of Natural Killer Cell Responses during Chronic Feline Immunodeficiency Virus Infection. Kaltenboeck B, ed. PLoS ONE. 2012;7(5):e37606. doi:10.1371/journal.pone.0037606 73. Foltz JA, Somanchi SS, Yang Y, Aquino-Lopez A, Bishop EE, Lee DA. NCR1 Expression Identifies Canine Natural Killer Cell Subsets with Phenotypic Similarity to Human Natural Killer Cells. Front Immunol. 2016;7:521. doi:10.3389/fimmu.2016.00521 74. Shin DJ, Park JY, Jang YY, et al. Ex vivo expansion of canine cytotoxic large granular lymphocytes exhibiting characteristics of natural killer cells. Veterinary Immunology and Immunopathology. 2013;153(3-4):249-259. doi:10.1016/j.vetimm.2013.03.006 75. Deuse T, Hu X, Agbor-Enoh S, et al. The SIRPα–CD47 immune checkpoint in NK cells. Journal of Experimental Medicine. 2021;218(3):e20200839. doi:10.1084/jem.20200839 37 76. Marquardt N, Wilk E, Pokoyski C, Schmidt RE, Jacobs R. Murine CXCR3 + CD27 bright NK cells resemble the human CD56 bright NK‐cell population. Eur J Immunol. 2010;40(5):1428-1439. doi:10.1002/eji.200940056 77. Milush JM, Long BR, Snyder-Cappione JE, et al. Functionally distinct subsets of human NK cells and monocyte/DC-like cells identified by coexpression of CD56, CD7, and CD4. Blood. 2009;114(23):4823-4831. doi:10.1182/blood- 2009-04-216374 78. Krijgsman D, de Vries NL, Skovbo A, et al. Characterization of circulating T-, NK-, and NKT cell subsets in patients with colorectal cancer: the peripheral blood immune cell profile. Cancer Immunol Immunother. 2019;68(6):1011-1024. doi:10.1007/s00262-019-02343-7 79. Hu Z, Gu W, Wei Y, Liu G, Wu S, Liu T. NKT Cells in Mice Originate from Cytoplasmic CD3-Positive, CD4−CD8− Double-Negative Thymocytes that Express CD44 and IL-7Rα. Sci Rep. 2019;9(1):1874. doi:10.1038/s41598-018- 37811-0 80. Johnston B, Kim CH, Soler D, Emoto M, Butcher EC. Differential Chemokine Responses and Homing Patterns of Murine TCRαβ NKT Cell Subsets. J Immunol. 2003;171(6):2960-2969. doi:10.4049/jimmunol.171.6.2960 81. Marchetti C, Borghetti P, Cacchioli A, et al. Profile of gamma-delta (γδ) T lymphocytes in the peripheral blood of crossbreed dogs during stages of life and 38 implication in aging. BMC Vet Res. 2020;16(1):278. doi:10.1186/s12917-020- 02504-2 82. Keller SM, Moore PF. A novel clonality assay for the assessment of canine T cell proliferations. Veterinary Immunology and Immunopathology. 2012;145(1- 2):410-419. doi:10.1016/j.vetimm.2011.12.019 83. Moore PF, Woo JC, Vernau W, Kosten S, Graham PS. Characterization of feline T cell receptor gamma (TCRG) variable region genes for the molecular diagnosis of feline intestinal T cell lymphoma. Veterinary Immunology and Immunopathology. 2005;106(3-4):167-178. doi:10.1016/j.vetimm.2005.02.014 84. Siegers GM, Swamy M, Fernández-Malavé E, et al. Different composition of the human and the mouse γδ T cell receptor explains different phenotypes of CD3γ and CD3δ immunodeficiencies. Journal of Experimental Medicine. 2007;204(11):2537-2544. doi:10.1084/jem.20070782 85. Ohara Y, Yabuki A, Nakamura R, et al. Renal Infiltration of Macrophages in Canine and Feline Chronic Kidney Disease. Journal of Comparative Pathology. 2019;170:53-59. doi:10.1016/j.jcpa.2019.05.006 86. Parisi F, Tesi M, Millanta F, Gnocchi M, Poli A. M1 and M2 tumour-associated macrophages subsets in canine malignant mammary tumours: An immunohistochemical study. Research in Veterinary Science. 2021;136:32-38. doi:10.1016/j.rvsc.2021.02.007 39 87. Vázquez S, Vallejo R, Espinosa J, Arteche N, Vega JA, Pérez V. Immunohistochemical Characterization of Tumor-Associated Macrophages in Canine Lymphomas. Animals. 2021;11(8):2301. doi:10.3390/ani11082301 88. Bertani FR, Mozetic P, Fioramonti M, et al. Classification of M1/M2-polarized human macrophages by label-free hyperspectral reflectance confocal microscopy and multivariate analysis. Sci Rep. 2017;7(1):8965. doi:10.1038/s41598-017- 08121-8 89. Jablonski KA, Amici SA, Webb LM, et al. Novel Markers to Delineate Murine M1 and M2 Macrophages. Olszewski MA, ed. PLoS ONE. 2015;10(12):e0145342. doi:10.1371/journal.pone.0145342 90. Lloyd CM, Phillips ARJ, Cooper GJS, Dunbar PR. Three-colour fluorescence immunohistochemistry reveals the diversity of cells staining for macrophage markers in murine spleen and liver. Journal of Immunological Methods. 2008;334(1-2):70-81. doi:10.1016/j.jim.2008.02.005 91. Spanholtz J, Preijers F, Tordoir M, et al. Clinical-Grade Generation of Active NK Cells from Cord Blood Hematopoietic Progenitor Cells for Immunotherapy Using a Closed-System Culture Process. Kaufman D, ed. PLoS ONE. 2011;6(6):e20740. doi:10.1371/journal.pone.0020740 92. Li Y, Schmidt-Wolf IGH, Wu YF, et al. Optimized Protocols for Generation of Cord Blood-derived Cytokine-induced Killer/Natural Killer Cells. Anticancer Res. 2010;30(9):3493-3499. 40 93. Rezvani K. Adoptive cell therapy using engineered natural killer cells. Bone Marrow Transplant. 2019;54(Suppl 2):785-788. doi:10.1038/s41409-019-0601-6 94. Bollino D, Webb TJ. Chimeric antigen receptor–engineered natural killer and natural killer T cells for cancer immunotherapy. Translational Research. 2017;187:32-43. doi:10.1016/j.trsl.2017.06.003 95. Nishimura Y, Shimojima M, Sato E, et al. Downmodulation of CD3epsilon expression in CD8alpha+beta- T cells of feline immunodeficiency virus-infected cats. J Gen Virol. 2004;85(Pt 9):2585-2589. doi:10.1099/vir.0.80102-0 96. Shimojima M, Nishimura Y, Miyazawa T, Kato K, Tohya Y, Akashi H. CD56 expression in feline lymphoid cells. J Vet Med Sci. 2003;65(7):769-773. doi:10.1292/jvms.65.769 97. Michael HT, Ito D, McCullar V, Zhang B, Miller JS, Modiano JF. Isolation and characterization of canine natural killer cells. Veterinary Immunology and Immunopathology. 2013;155(3):211-217. doi:10.1016/j.vetimm.2013.06.013 98. Canter RJ, Grossenbacher SK, Foltz JA, et al. Radiotherapy enhances natural killer cell cytotoxicity and localization in pre-clinical canine sarcomas and first- in-dog clinical trial. j immunotherapy cancer. 2017;5(1):98. doi:10.1186/s40425- 017-0305-7 41 99. Liu E, Marin D, Banerjee P, et al. Use of CAR-Transduced Natural Killer Cells in CD19-Positive Lymphoid Tumors. N Engl J Med. 2020;382(6):545-553. doi:10.1056/NEJMoa1910607 100. Liu E, Tong Y, Dotti G, et al. Cord blood NK cells engineered to express IL-15 and a CD19-targeted CAR show long-term persistence and potent antitumor activity. Leukemia. 2018;32(2):520-531. doi:10.1038/leu.2017.226 101. Imamura M, Shook D, Kamiya T, et al. Autonomous growth and increased cytotoxicity of natural killer cells expressing membrane-bound interleukin-15. Blood. 2014;124(7):1081-1088. doi:10.1182/blood-2014-02-556837 102. Bernin H, Fehling H, Marggraff C, Tannich E, Lotter H. The cytokine profile of human NKT cells and PBMCs is dependent on donor sex and stimulus. Med Microbiol Immunol. 2016;205(4):321-332. doi:10.1007/s00430-016-0449-y 103. Bendelac A, Savage PB, Teyton L. The Biology of NKT Cells. Annu Rev Immunol. 2007;25(1):297-336. doi:10.1146/annurev.immunol.25.022106.141711 104. Yasuda N, Masuda K, Tsukui T, Teng A, Ishii Y. Identification of canine natural CD3-positive T cells expressing an invariant T-cell receptor alpha chain. Veterinary Immunology and Immunopathology. 2009;132(2-4):224-231. doi:10.1016/j.vetimm.2009.08.002 42 105. Rotolo A, Caputo VS, Holubova M, et al. Enhanced Anti-lymphoma Activity of CAR19-iNKT Cells Underpinned by Dual CD19 and CD1d Targeting. Cancer Cell. 2018;34(4):596-610.e11. doi:10.1016/j.ccell.2018.08.017 106. Xu X, Huang W, Heczey A, et al. NKT Cells Coexpressing a GD2-Specific Chimeric Antigen Receptor and IL15 Show Enhanced In Vivo Persistence and Antitumor Activity against Neuroblastoma. Clin Cancer Res. 2019;25(23):7126- 7138. doi:10.1158/1078-0432.CCR-19-0421 107. Hara A, Koyama-Nasu R, Takami M, et al. CD1d expression in glioblastoma is a promising target for NKT cell-based cancer immunotherapy. Cancer Immunol Immunother. 2021;70(5):1239-1254. doi:10.1007/s00262-020-02742-1 108. Chong TW, Goh FY, Sim MY, et al. CD1d expression in renal cell carcinoma is associated with higher relapse rates, poorer cancer-specific and overall survival. J Clin Pathol. 2015;68(3):200-205. doi:10.1136/jclinpath-2014-202735 109. Heczey A, Courtney AN, Montalbano A, et al. Anti-GD2 CAR-NKT cells in patients with relapsed or refractory neuroblastoma: an interim analysis. Nat Med. 2020;26(11):1686-1690. doi:10.1038/s41591-020-1074-2 110. Guerra-Maupome M, Slate JR, McGill JL. Gamma Delta T Cell Function in Ruminants. Veterinary Clinics of North America: Food Animal Practice. 2019;35(3):453-469. doi:10.1016/j.cvfa.2019.08.001 43 111. Hein WR, Mackay CR. Prominence of γδ T cells in the ruminant immune system. Immunology Today. 1991;12(1):30-34. doi:10.1016/0167- 5699(91)90109-7 112. Capsomidis A, Benthall G, Van Acker HH, et al. Chimeric Antigen Receptor- Engineered Human Gamma Delta T Cells: Enhanced Cytotoxicity with Retention of Cross Presentation. Molecular Therapy. 2018;26(2):354-365. doi:10.1016/j.ymthe.2017.12.001 113. Massari S, Bellahcene F, Vaccarelli G, et al. The deduced structure of the T cell receptor gamma locus in Canis lupus familiaris. Molecular Immunology. 2009;46(13):2728-2736. doi:10.1016/j.molimm.2009.05.008 114. Nielsen MM, Witherden DA, Havran WL. γδ T cells in homeostasis and host defence of epithelial barrier tissues. Nat Rev Immunol. 2017;17(12):733-745. doi:10.1038/nri.2017.101 115. Almeida AR, Correia DV, Fernandes-Platzgummer A, et al. Delta One T Cells for Immunotherapy of Chronic Lymphocytic Leukemia: Clinical-Grade Expansion/Differentiation and Preclinical Proof of Concept. Clinical Cancer Research. 2016;22(23):5795-5804. doi:10.1158/1078-0432.CCR-16-0597 116. Pathria P, Louis TL, Varner JA. Targeting Tumor-Associated Macrophages in Cancer. Trends in Immunology. 2019;40(4):310-327. doi:10.1016/j.it.2019.02.003 44 117. Mosser DM, Edwards JP. Exploring the full spectrum of macrophage activation. Nat Rev Immunol. 2008;8(12):958-969. doi:10.1038/nri2448 118. Burger M, Thiounn N, Denzinger S, et al. The application of adjuvant autologous antravesical macrophage cell therapy vs. BCG in non-muscle invasive bladder cancer: a multicenter, randomized trial. J Transl Med. 2010;8(1):54. doi:10.1186/1479-5876-8-54 119. Klichinsky M, Ruella M, Shestova O, et al. Human chimeric antigen receptor macrophages for cancer immunotherapy. Nat Biotechnol. Published online March 23, 2020. doi:10.1038/s41587-020-0462-y 120. Weiskopf K, Anderson KL, Ito D, et al. Eradication of Canine Diffuse Large B- Cell Lymphoma in a Murine Xenograft Model with CD47 Blockade and Anti- CD20. Cancer Immunology Research. 2016;4(12):1072-1087. doi:10.1158/2326- 6066.CIR-16-0105 121. Kurzman ID, Shi F, Vail DM, MacEwen EG. In Vitro and In Vivo Enhancement of Canine Pulmonary Alveolar Macrophage Cytotoxic Activity Against Canine Osteosarcoma Cells. Cancer Biotherapy and Radiopharmaceuticals. 1999;14(2):121-128. doi:10.1089/cbr.1999.14.121 122. Hogge GS, Burkholder JK, Culp J, et al. Development of Human Granulocyte- Macrophage Colony-Stimulating Factor-Transfected Tumor Cell Vaccines for the Treatment of Spontaneous Canine Cancer. Human Gene Therapy. 1998;9(13):1851-1861. doi:10.1089/hum.1998.9.13-1851 45 123. Fox LE, MacEwen EG, Kurzman RD, et al. Liposome-encapsulated Muramyl Tripeptide Phosphatidylethanolamine for the Treatment of Feline Mammary Adenocarcinoma-A Multicenter Randomized Double-blind Study. Cancer Biotherapy. 1995;10(2):125-130. doi:10.1089/cbr.1995.10.125 124. Nilsson M, Ljungberg J, Richter J, et al. Development of an adenoviral vector system with adenovirus serotype 35 tropism; efficient transient gene transfer into primary malignant hematopoietic cells. J Gene Med. 2004;6(6):631-641. doi:10.1002/jgm.543 125. Maldini CR, Ellis GI, Riley JL. CAR T cells for infection, autoimmunity and allotransplantation. Nat Rev Immunol. 2018;18(10):605-616. doi:10.1038/s41577-018-0042-2 126. Krickau T, Naumann-Bartsch N, Aigner M, et al. CAR T-cell therapy rescues adolescent with rapidly progressive lupus nephritis from haemodialysis. The Lancet. 2024;403(10437):1627-1630. doi:10.1016/S0140-6736(24)00424-0 127. Mackensen A, Müller F, Mougiakakos D, et al. Anti-CD19 CAR T cell therapy for refractory systemic lupus erythematosus. Nat Med. 2022;28(10):2124-2132. doi:10.1038/s41591-022-02017-5 128. Guo X, Kazanova A, Thurmond S, Saragovi HU, Rudd CE. Effective chimeric antigen receptor T cells against SARS-CoV-2. iScience. 2021;24(11):103295. doi:10.1016/j.isci.2021.103295 46 129. Fu W, Lei C, Qian K, et al. CAR Macrophages for SARS-CoV-2 Immunotherapy. Bioengineering; 2020. doi:10.1101/2020.07.26.222208 130. Maldini CR, Claiborne DT, Okawa K, et al. Dual CD4-based CAR T cells with distinct costimulatory domains mitigate HIV pathogenesis in vivo. Nat Med. 2020;26(11):1776-1787. doi:10.1038/s41591-020-1039-5 131. Anthony-Gonda K, Bardhi A, Ray A, et al. Multispecific anti-HIV duoCAR-T cells display broad in vitro antiviral activity and potent in vivo elimination of HIV-infected cells in a humanized mouse model. Sci Transl Med. 2019;11(504):eaav5685. doi:10.1126/scitranslmed.aav5685 132. Sautto GA, Wisskirchen K, Clementi N, et al. Chimeric antigen receptor (CAR)- engineered T cells redirected against hepatitis C virus (HCV) E2 glycoprotein. Gut. 2016;65(3):512-523. doi:10.1136/gutjnl-2014-308316 133. Kim DH, Han HJ, Kim JH. Successful management of systemic lupus erythematosus with levamisole in a Dachshund dog. Korean J Vet Res. 2021;61(1):e1. doi:10.14405/kjvr.2021.61.e1 134. Monestier M, Novick KE, Karam ET, Chabanne L, Monier JC, Rigal D. Autoantibodies to histone, DNA and nucleosome antigens in canine systemic lupus erythematosus. Clinical and Experimental Immunology. 2008;99(1):37-41. doi:10.1111/j.1365-2249.1995.tb03469.x 47 135. Shimojima M, Miyazawa T, Ikeda Y, et al. Use of CD134 As a Primary Receptor by the Feline Immunodeficiency Virus. Science. 2004;303(5661):1192-1195. doi:10.1126/science.1092124 136. Jaimes JA, Whittaker GR. Feline coronavirus: Insights into viral pathogenesis based on the spike protein structure and function. Virology. 2018;517:108-121. doi:10.1016/j.virol.2017.12.027 137. Jaimes JA, Millet JK, Stout AE, André NM, Whittaker GR. A Tale of Two Viruses: The Distinct Spike Glycoproteins of Feline Coronaviruses. Viruses. 2020;12(1):E83. doi:10.3390/v12010083 138. Herrewegh AAPM, Smeenk I, Horzinek MC, Rottier PJM, De Groot RJ. Feline Coronavirus Type II Strains 79-1683 and 79-1146 Originate from a Double Recombination between Feline Coronavirus Type I and Canine Coronavirus. J Virol. 1998;72(5):4508-4514. doi:10.1128/JVI.72.5.4508-4514.1998 139. Hohdatsu T, Izumiya Y, Yokoyama Y, Kida K, Koyama H. Differences in virus receptor for type I and type II feline infectious peritonitis virus. Arch Virol. 1998;143(5):839-850. doi:10.1007/s007050050336 140. Takano T, Kawakami C, Yamada S, Satoh R, Hohdatsu T. Antibody-dependent enhancement occurs upon re-infection with the identical serotype virus in feline infectious peritonitis virus infection. J Vet Med Sci. 2008;70(12):1315-1321. doi:10.1292/jvms.70.1315 48 141. Takano T, Katada Y, Moritoh S, et al. Analysis of the mechanism of antibody- dependent enhancement of feline infectious peritonitis virus infection: aminopeptidase N is not important and a process of acidification of the endosome is necessary. J Gen Virol. 2008;89(Pt 4):1025-1029. doi:10.1099/vir.0.83558-0 142. Olsen CW, Corapi WV, Jacobson RH, Simkins RA, Saif LJ, Scott FW. Identification of antigenic sites mediating antibody-dependent enhancement of feline infectious peritonitis virus infectivity. J Gen Virol. 1993;74 ( Pt 4):745- 749. doi:10.1099/0022-1317-74-4-745 143. Corapi WV, Olsen CW, Scott FW. Monoclonal antibody analysis of neutralization and antibody-dependent enhancement of feline infectious peritonitis virus. J Virol. 1992;66(11):6695-6705. doi:10.1128/JVI.66.11.6695- 6705.1992 144. Larsen MD, De Graaf EL, Sonneveld ME, et al. Afucosylated IgG characterizes enveloped viral responses and correlates with COVID-19 severity. Science. 2021;371(6532):eabc8378. doi:10.1126/science.abc8378 145. Hartmann K. Feline infectious peritonitis. Veterinary Clinics of North America: Small Animal Practice. 2005;35(1):39-79. doi:10.1016/j.cvsm.2004.10.011 146. Heeney JL, Evermann JF, McKeirnan AJ, et al. Prevalence and implications of feline coronavirus infections of captive and free-ranging cheetahs (Acinonyx jubatus). J Virol. 1990;64(5):1964-1972. doi:10.1128/jvi.64.5.1964-1972.1990 49 147. Warr A, Attipa C, Gunn‐Moore D, Tait‐Burkard C. FCoV‐23 causing FIP in a cat imported to the UK from Cyprus. Veterinary Record. 2023;193(10):414-415. doi:10.1002/vetr.3696 148. Brown EW, Olmsted RA, Martenson JS, O’Brien SJ. Exposure to FIV and FIPV in wild and captive cheetahs. Zoo Biology. 1993;12(1):135-142. doi:10.1002/zoo.1430120112 149. Holzworth J. Some important disorders of cats. Cornell Vet. 1963;53:157-160. 150. Marioni‐Henry K, Vite CH, Newton AiL, Van Winkle TJ. Prevalence of Diseases of the Spinal Cord of Cats. Veterinary Internal Medicne. 2004;18(6):851-858. doi:10.1111/j.1939-1676.2004.tb02632.x 151. Pedersen NC. A review of feline infectious peritonitis virus infection: 1963-2008. J Feline Med Surg. 2009;11(4):225-258. doi:10.1016/j.jfms.2008.09.008 152. Crawford AH, Stoll AL, Sanchez-Masian D, et al. Clinicopathologic Features and Magnetic Resonance Imaging Findings in 24 Cats With Histopathologically Confirmed Neurologic Feline Infectious Peritonitis. J Vet Intern Med. 2017;31(5):1477-1486. doi:10.1111/jvim.14791 153. Colitz CMH. Feline uveitis: diagnosis and treatment. Clin Tech Small Anim Pract. 2005;20(2):117-120. doi:10.1053/j.ctsap.2004.12.016 154. Satoh R, Kaku A, Satomura M, et al. Development of monoclonal antibodies (MAbs) to feline interferon (fIFN)-γ as tools to evaluate cellular immune 50 responses to feline infectious peritonitis virus (FIPV). J Feline Med Surg. 2011;13(6):427-435. doi:10.1016/j.jfms.2011.01.008 155. Haagmans BL, Egberink HF, Horzinek MC. Apoptosis and T-cell depletion during feline infectious peritonitis. J Virol. 1996;70(12):8977-8983. doi:10.1128/jvi.70.12.8977-8983.1996 156. Addie D, Belák S, Boucraut-Baralon C, et al. Feline Infectious Peritonitis: ABCD Guidelines on Prevention and Management. Journal of Feline Medicine and Surgery. 2009;11(7):594-604. doi:10.1016/j.jfms.2009.05.008 157. Fischer Y, Sauter‐Louis C, Hartmann K. Diagnostic accuracy of the R ivalta test for feline infectious peritonitis. Veterinary Clinical Pathol. 2012;41(4):558-567. doi:10.1111/j.1939-165X.2012.00464.x 158. Stranieri A, Scavone D, Paltrinieri S, et al. Concordance between Histology, Immunohistochemistry, and RT-PCR in the Diagnosis of Feline Infectious Peritonitis. Pathogens. 2020;9(10):E852. doi:10.3390/pathogens9100852 159. Gut M, Leutenegger CM, Huder JB, Pedersen NC, Lutz H. One-tube fluorogenic reverse transcription-polymerase chain reaction for the quantitation of feline coronaviruses. J Virol Methods. 1999;77(1):37-46. doi:10.1016/s0166- 0934(98)00129-3 51 160. Hartmann K, Binder C, Hirschberger J, et al. Comparison of Different Tests to Diagnose Feline Infectious Peritonitis. Veterinary Internal Medicne. 2003;17(6):781-790. doi:10.1111/j.1939-1676.2003.tb02515.x 161. Kiss I, Poland AM, Pedersen NC. Disease outcome and cytokine responses in cats immunized with an avirulent feline infectious peritonitis virus (FIPV)-UCD1 and challenge-exposed with virulent FIPV-UCD8. Journal of Feline Medicine and Surgery. 2004;6(2):89-97. doi:10.1016/j.jfms.2003.08.009 162. Reeves NC, Pollock RV, Thurber ET. Long-term follow-up study of cats vaccinated with a temperature-sensitive feline infectious peritonitis vaccine. Cornell Vet. 1992;82(2):117-123. 163. US Food and Drug Administration. FDA Announces Position on Use of Compounded GS-441524 to Treat FIP. May 10, 2024. Accessed November 16, 2024. https://www.fda.gov/animal-veterinary/cvm-updates/fda-announces- position-use-compounded-gs-441524-treat-fip 164. Taylor SS, Coggins S, Barker EN, et al. Retrospective study and outcome of 307 cats with feline infectious peritonitis treated with legally sourced veterinary compounded preparations of remdesivir and GS-441524 (2020–2022). Journal of Feline Medicine and Surgery. 2023;25(9):1098612X231194460. doi:10.1177/1098612X231194460 52 165. Green J, Syme H, Tayler S. Thirty‐two cats with effusive or non‐effusive feline infectious peritonitis treated with a combination of remdesivir and GS‐441524. Veterinary Internal Medicne. 2023;37(5):1784-1793. doi:10.1111/jvim.16804 166. Coggins SJ, Norris JM, Malik R, et al. Outcomes of treatment of cats with feline infectious peritonitis using parenterally administered remdesivir, with or without transition to orally administered GS ‐441524. Veterinary Internal Medicne. 2023;37(5):1772-1783. doi:10.1111/jvim.16803 167. Pedersen NC, Perron M, Bannasch M, et al. Efficacy and safety of the nucleoside analog GS-441524 for treatment of cats with naturally occurring feline infectious peritonitis. J Feline Med Surg. 2019;21(4):271-281. doi:10.1177/1098612X19825701 168. Murphy BG, Perron M, Murakami E, et al. The nucleoside analog GS-441524 strongly inhibits feline infectious peritonitis (FIP) virus in tissue culture and experimental cat infection studies. Vet Microbiol. 2018;219:226-233. doi:10.1016/j.vetmic.2018.04.026 169. O’Brien A, Mettelman RC, Volk A, André NM, Whittaker GR, Baker SC. Characterizing replication kinetics and plaque production of type I feline infectious peritonitis virus in three feline cell lines. Virology. 2018;525:1-9. doi:10.1016/j.virol.2018.08.022 53 170. Jacobse-Geels HE, Horzinek MC. Expression of feline infectious peritonitis coronavirus antigens on the surface of feline macrophage-like cells. J Gen Virol. 1983;64 (Pt 9):1859-1866. doi:10.1099/0022-1317-64-9-1859 171. Cornelissen E, Dewerchin HL, Van Hamme E, Nauwynck HJ. Absence of surface expression of feline infectious peritonitis virus (FIPV) antigens on infected cells isolated from cats with FIP. Vet Microbiol. 2007;121(1-2):131-137. doi:10.1016/j.vetmic.2006.11.026 54 CHAPTER 2 Generation of primary feline chimeric antigen receptor T cells* *Published: Cockey, J. R., Zhou, G. M., Kulp, E. N., Urbina, C. A., Kerkenpaß, C., & Leifer, C. A. (2025). Generation of primary feline chimeric antigen receptor T cells. American Journal of Veterinary Research, 86(1), ajvr.24.08.0247. https://doi.org/10.2460/ajvr.24.08.0247 Contributions: JRC and CAL conceived the study design. JRC processed blood donor blood, enriched, and cultured primary T cells for all experiments. JRC and GMZ performed ELISA, GMZ, ENK, and CAU performed qPCR. JRC and CK generated CD19- cell line . JRC , GMZ, and CAL wrote the manuscript. 55 Abstract Chimeric antigen receptor (CAR) T cell therapy has been successfully utilized for the treatment of human hematological malignancies. Because of the success observed in humans, investigations of CAR T cell therapy have begun in veterinary medicine. However, these studies have focused almost entirely on developing CAR T cell therapies to treat canine cancers. Here, we present the first study exploring development of feline CAR T cells. We first established an enrichment strategy for primary feline T cells from donor blood using magnetic-activated cell sorting for CD3, yielding >97% CD3+ cells . We next optimized the growth conditions for feline T cell growth, in which interleukin(IL)-2 with concanavalin A or phorbol myristate acetate and ionomycin (PMA/I) induced multiple rounds of division as well as activation of both CD4+ and CD8+ subsets over 96 hours, but PMA/I yielded higher total T cell expansion over 12 days. PMA/I also induced more robust polarization towards TH1- like and Treg-like phenotypes as compared to concanavalin A when combined with polarizing cytokine milieu. Lastly, we engineered feline CAR T cells by lentiviral transduction using a feline immunodeficiency virus-based system to express a human CD19 CAR. Feline CD19 CAR T cells demonstrated specific cytotoxicity against human CD19+ target cells.. In all, this study is the first reported generation of primary feline CAR T cells and establishes optimization of feline T cell polarization and expansion conditions that may lay the foundation for future development of CAR T cell therapy for multiple feline diseases. 56 2.1 Introduction Human CAR T cell therapy has been used to successfully treat B cell leukemia and lymphoma, as well as multiple myeloma, and there are currently six US Food and Drug Administration approved CAR T cell products.1 CAR T therapy is being explored in preclinical models and clinical trials for additional indications including infectious diseases and autoimmunity.2–8 CAR T therapy involves infusion of engineered autologous T cells expressing a chimeric receptor specific for an antigen on target cells.9 The CAR is comprised of a single chain variable fragment tethered by a hinge domain to a transmembrane domain and one or more cytoplasmic domains derived from the T cell receptor signaling complex and costimulatory molecules.10,11 The success of CAR T therapy in treating human cancer patients has spurred investigation in veterinary medicine into the design and manufacturing of CAR T cells for companion animals. The first report of canine CAR T cells tested growth conditions such as artificial antigen presenting cells, anti-canine CD3/CD28 beads, or concanavalin A (ConA) to expand T cells, and generated the first-in-canine CAR T cells by electroporating mRNA encoding a canine CD20 CAR to treat a patient with B cell lymphoma.12 Subsequent studies utilized viral transduction for CAR T generation,13,14 and compared various media formulations with mitogenic stimuli like ConA, phytohemagglutinin and phorbol myristate acetate with ionomycin (PMA/I) for 57 their ability to support efficient canine T cell transduction.15 Additional studies have generated canine CAR T cells directed towards solid tumor antigens such as B7-H3 and IL-13Ra2.16,17 Despite these developments in CAR T therapy for dogs, no such investigations have been conducted for cats. Humans, dogs, and cats share similar environmental exposures, and all develop spontaneous cancer; therefore, in addition to direct benefits for treating feline cancer, feline CAR T development may provide opportunities for translation to human oncology. Here we tested the optimal growth conditions for feline T cells using cytokine and mitogen combinations previously demonstrated to grow human and canine T cells. We also tested whether feline T cells could be polarized with different cytokine and mitogenic stimuli in vitro to more TH1-like or Treg-like phenotypes that could have future use in augmenting CAR T therapy for infectious and autoimmune diseases. We found that recombinant feline IL-2 with ConA or PMA/I yielded robust proliferation and activation, but PMAI/I resulted in higher response to polarizing cytokines and ex vivo expansion. Finally, we utilized an FIV-based lentiviral system to transduce primary feline T cells with a human CD19 CAR and observed specific cytotoxicity against human CD19+ target cells. Together, these data demonstrate the optimal conditions for feline T cell growth and polarization, as well as the novel generation of functional feline CAR T cells. 58 2.2 Methods 2.2.1 Primary feline T cell isolation Venipunctures on healthy donor cats were carried out by the Cornell Center for Animal Resources and Education following protocols approved by IACUC. Individual donor characteristics are listed in Supplementary Table 2.1. Heparinized blood was diluted up to 35 mL with 1X Dulbecco’s PBS (DPBS), layered over Ficoll Paque PREMIUM (Cytiva), and spun at 400xg for 30 minutes at 20°C with no brake. Peripheral blood mononuclear cells (PBMCs) were washed twice with magnetic activated cell sorting (MACS) buffer (1X DPBS + 0.5% BSA + 2mM EDTA) at 200xg for 10 minutes at 20°C to remove platelets. T cells were incubated with anti-feline CD3 clone NZM118 hybridoma supernatant (Y. Nishimura, National Institute of Infectious Diseases, Tokyo, Japan) for 30 minutes at 4°C, washed with MACS buffer followed by incubation with anti-mouse IgG Microbeads (Miltenyi Biotec) at 4°C for 15 min. Cells were washed with MACS buffer and positively selected using an MS Column (Miltenyi Biotec). Cells were stained for flow cytometry and/or put into culture in complete media (XVIVO-15 [Lonza] + 10% fetal bovine serum [Avantor Seradigm] + 2mM L-glutamine [Corning]) as specified for each assay. 2.2.2 T cell labeling and stimulation PBMCs were washed twice with MACS buffer and labeled in DPBS with 5 mM CellTrace Violet (Invitrogen) for 20 minutes at 37°C prior to addition of 5 volumes of complete XVIVO-15. An aliquot was removed to compare T cell percentage pre- and post-enrichment before proceeding with T cell enrichment as described above. 1x105 59 enriched T cells/well were seeded in 100 mL of complete XVIVO-15 in 96 well round bottom tissue culture plates (Thermo) with 10 ng/mL recombinant feline IL-2 (rfIL-2 [R&D Systems]) alone or in combination with 100 ng/mL recombinant human IL-21 (Peprotech), 5 mg/mL Concanavalin A (Sigma), or 25 ng/mL phorbol myristate acetate (PMA [Sigma]) + 1 mg/mL ionomycin (Sigma) for 24 hours. Medium was exchanged to remove mitogenic stimuli and rfIL-2 (for rfIL-2 alone, ConA, and PMA/I) or rfIL-2 with rhIL-21 was added and cells were cultured for an additional three days. Cells were either stained for viability and CD4/CD8/CD134 expression or CD3 purity. Gating strategy detailed in Figure 2.1. 2.2.3 Flow cytometry Cell viability was determined by staining cells in LIVE/DEAD Near IR (Invitrogen) diluted in DPBS according to manufacturer’s instructions. Antibodies used were anti- feline CD4 FITC (Bio-Rad, clone vpg34), anti-feline CD8 PE (Southern Biotech, clone fCD8), anti-feline CD134 AlexaFluor 647(Bio-Rad, clone 7D6), goat anti- mouse IgG3 AlexaFluor 488 (Invitrogen), anti-human CD19 FITC (BioLegend, clone HIB19), anti-human CD271 (for truncated nerve growth factor receptor [LNGFR]) BV421 (BD, clone C40-1457). Primary and secondary antibodies were diluted in flow cytometry buffer (DPBS + 1% bovine serum albumin [Roche] + 0.1% NaNH3 + 1 mM EDTA) and stained for 30 minutes at 4°C in the dark. Cells were washed with flow cytometry buffer before fixing and staining in Cytofix/Cytoperm solution (BD) for 5 minutes at 4°C. Proliferation was determined by flow cytometry through CellTrace violet dilution. All T cell experiments were analyzed on an Attune NxT Acoustic 60 Focusing Cytometer (Thermo). Analysis was carried out using FlowJo 10.6.2 software (BD). Antibody dilutions are listed in Table 2.2. 2.2.4 T cell Expansion 1x106 primary T cells/well were seeded onto a G-Rex 24 well plate (Wilson Wolf) in a total volume of 1 mL/well complete XVIVO-15 with 10 ng/mL rfIL-2 and either 5 mg/mL ConA or 25 ng/mL PMA + 1 mg/mL ionomycin. 24 hours later media volume was increased to 8 mL/well with complete XVIVO-15 + 10 ng/mL rfIL-2. On days 4, 8, and 12 post-seeding, half of the media was replenished with XVIVO-15 + 10 ng/mL rfIL-2 and viable cells were counted on a hemocytometer using trypan blue. 2.2.5 THelper cell polarization 1x105 enriched T cells/well were seeded in 100 μL complete XVIVO-15 in 96 well round bottom tissue culture plates with 10 ng/mL rfIL-2 and either 5 μg/mL ConA or 25 ng/mL PMA + 1 mg/mL ionomycin. Polarizing conditions consisted of 10 ng/mL rfIL-2 without additional cytokines (TH0) or with 10 ng/mL recombinant feline IL-12 (TH1) or 2 ng/mL recombinant human TGF-b1 (Treg) (both from R&D Systems). The next day, wells were adjusted to 200 μL by removing 50 μL and adding 150 μL fresh polarization mixture without mitogens but adjusting to the polarizing conditions with cytokines. On day 4, each well was split into two wells and respective cytokines were added, and cells were cultured for an additional two days. Detailed RNA isolation, cDNA generation, and quantitative PCR protocols are listed below. All primers were 61 purchased as oligonucleotides (Integrated DNA Technologies) and are listed in Table 2.3. 2.2.6 ELISA On day 6 supernatants from each polarization condition per donor were clarified at 400xg, pooled, and stored at -80°C. Interferon-g and IL-10 were quantified using Feline Interferon-g and Feline IL-10 DuoSet ELISA kits (R&D Systems) according to manufacturer’s instructions in triplicate technical replicates per condition from each donor. Absorbance was measured at 450nm on a Biotek Synergy H1 plate reader (Agilent). Data were analyzed and graphed in Prism 6 (GraphPad). 2.2.7 1928Z-LNGFR CAR vector cloning A Fragment Gene (Azenta Life Sciences) was designed encoding the second generation anti-human CD1928Z-LNGFR CAR sequence19 (M. Sadelain, Memorial Sloan Kettering Cancer Center) and a Kozak consensus sequence GCCACCATGG. 5’ PmeI and 3’ BamHI sites were added by PCR with Pfu Ultra II HS polymerase (Agilent). pTiger (Addgene #1728) and the 1928Z-LNGFR gene fragment were digested with PmeI and BamHI-HF (NEB), run on a 1% agarose gel, and extracted with the GeneJET gel extraction kit (Thermo) before subsequent ligation and transformation into NEB Stable E. coli (NEB). Cloned plasmid was selected from a single colony, expanded, and purified using EndoFree Plasmid Maxi kit (Qiagen). The sequence was confirmed by whole-plasmid sequencing (Plasmidsaurus) and annotated with PLannotate v1.2.2. 62 2.2.8 Cell line culture HEK293T cells (H. Aguilar-Carreno, Cornell) and Raji B cells (K. Richards, Cornell) were cultured in Dulbecco’s Modified Eagle’s Medium (Corning) or RPMI 1640 (Corning), respectively, and supplemented with 10% fetal bovine serum, 2 mM L- glutamine, 1% penicillin-streptomycin (Corning), 2.5 mg/mL amphotericin B (Gibco), 1 mM sodium pyruvate (Corning), and 10 mM HEPES (Corning). 2.2.9 Primary T cell lentiviral transduction The day before transfection, 2.5x106 HEK293T cells per plate were seeded onto duplicate 10 cm tissue culture plates. The next day, medium was exchanged to 8.8 mL per plate complete Dulbecco’s Modified Eagle’s Medium without antibiotics two hours prior to transfection. 7.5 mg pTiger-1928Z-LNGFR, 12.5 mg CF1DEnv FIV packaging vector20 (E. Poeschla, U Colorado) and 5 mg HDM-VSV-G (G. Mostoslavsky, Boston University) were added to 1.1 mL of Opti-MEM (Gibco) in duplicate Eppendorf tubes prior to adding 75 mL of FUGENE HD (Promega) to each tube and incubating for 15 minutes before adding to cells. Fresh media was exchanged 24 hours later. 48- and 72-hour supernatants were spun at 2000xg at 4°C and clarified through a 0.45 mm PES syringe filter (Nest Scientific). Clarified supernatants were pooled and concentrated at 100,000xg for 90 minutes at 4°C in an Optima XPN-80 ultracentrifuge (Beckman Coulter) using a SW32 Ti rotor and ultracentrifuge tubes (Beckman Coulter). The virus pellet was resuspended in 400 mL basal XVIVO-15 without additives, aliquoted, and stored at -80°C. Lentivirus was titered using 63 HEK293T and calculated based on LNGFR expression by flow cytometry.21 1x106 CD3-enriched primary feline T cells expanded in G-Rex® plates were resuspended in a total volume of 500 mL of basal XVIVO-15 with 10 ng/mL rfIL-2 and 8 mg/mL polybrene (Sigma) with or without lentivirus (MOI»1) and aliquoted to one well of a 24 well tissue culture plate. Cells were spinoculated at 400xg for 2 hours at 32°C then placed in the 37°C at 5% CO2 incubator for another two hours. Cells were then transferred to one well of a G-Rex® 24 well plate in 8 mL total volume complete XVIVO-15 with 10 ng/mL rfIL-2. 2.2.10 Cytotoxicity assay Raji wild type or CD19 deficient target cells (generated using CRISPR/Cas9, Supplementary methods) were stained with 5 mM CellTrace Violet. 2x105 Mock or lentivirus-transduced effector T cells (51-77% transduction) were seeded with 2x104 target cells in a total of 200 mL complete XVIVO-15 with 10 ng/mL rfIL-2 per well of 96 well V bottom plate (Nest Scientific). Cells were co-cultured for 4 hours in triplicate for both target cell lines. Target cells cultured alone were used to determine spontaneous death. The cells were washed with DPBS, stained with LIVE/DEAD Near IR, washed with flow cytometry buffer, fixed with Cytofix/Cytoperm, washed two more times, and resuspended in 200 mL flow buffer. Viability was determined by flow cytometry using an Attune NxT CytKick Max Autosampler (Thermo) recording 1x104 single CellTrace Violet+ events per well. Percent cytotoxicity was calculated by subtracting the mean percentage of spontaneous dead targets (CellTrace 64 Violet+LIVE/DEAD+) from the percentage dead in co-culture for both respective target cell lines. 2.2.11 CD19 deficient Raji cell generation Human CD19 CRISPR gRNA oligonucleotides (Integrated DNA Technologies) were designed using CrispRGold software (https://crisprgold.mdc-berlin.de/index.php). To create CD19 LentiCRISPR, LentiCRISPRv2 (J. Schimenti, Cornell) was digested with Esp31 (NEB). The forward 5’ CACCGCTAGGTCCGAAACATTCCAC 3’ and reverse 5’AAACGTGGAATGTTTCGGACCTAGC 3’ oligonucleotides were annealed at 95°C then ligated into digested LentiCRISPRv2. Sequence identity was confirmed through Sanger sequencing at the Cornell Institute of Biotechnology Genomics Core facility. The day before transfection, 2.5x106 HEK293T cells per plate were seeded onto duplicate 10 cm tissue culture plates. The next day, medium was exchanged to 8.8 mL per plate complete Dulbecco’s Modified Eagle’s Medium (Corning) without antibiotics two hours prior to transfection. 20 µg of human CD19 LentiCRISPR, 1 µg HDM-Tat1b, 1 µg Rc-CMV-Rev, 1 µg HDM-Hgpm2 (G. Mostoslavsky, Boston University), and 2 µg pLTR-RD114A (Addgene plasmid# 17576) were added to 1.1 mL of Opti-MEM (Gibco) in duplicate and mixed by pipetting. 75 µL of FUGENE HD (Promega) was added to each mixture and incubated for 15 minutes at room temperature before adding dropwise to each plate of cells. Media was exchanged 24 hours later. Supernatant was collected at 48 and 72 hours, spun at 2000xg for 10 minutes at 4°C and clarified through a 0.45 µm PES syringe filter (Nest Scientific). Clarified supernatant was pooled at 72 hours in an 65 ultracentrifuge tube (Beckman Coulter) and concentrated at 100,000xg for 90 minutes at 4°C in an Optima XPN-80 ultracentrifuge (Beckman Coulter) using an SW32 Ti rotor. Virus pellet then dissolved in 500 µL basal RPMI 1640 without additives. 10 µL of 1 mg/mL Vectofusin-1 (Miltenyi Biotec) was added to a separate tube of containing 490 µL basal RPMI and combined with the virus pellet to a final concentration of 10 µg/mL Vectofusin-1. 2x106 Raji B cells were resuspended in the virus/Vectofusin mixture and transferred to a 12 well tissue culture plate. Cells were spinoculated at 400xg for two hours at 32°C then placed in the 37°C with 5% CO2 incubator for another two hours before adding 1 mL complete RPMI and incubating overnight. Medium was exchanged the following day, and viable CD19- Raji cells were enriched on a FACS Melody Sorter (BD). CD19 knockout cells were maintained in complete RPMI with 1 µg/mL puromycin (Invivogen). 2.2.12 RNA isolation and cDNA preparation for polarized T cells On day 6 of culture in polarizing cytokines, cells that were stimulated under the same conditions were pooled, pelleted at 400xg for five minutes, and lysed with 1 mL TRIzol reagent (Thermo). After a five-minute incubation at room temperature, 0.2 mL of chloroform was added followed by mixing and incubating at room temperature for an additional three minutes. Tubes were then centrifuged at 12,000xg for 15 minutes at 4°C and the upper aqueous layer was transferred to a new tube with 10 μg GlycoBlue (Ambion). RNA was precipitated with the addition of 0.5 mL isopropyl alcohol and centrifuging at 12,000xg for 10 minutes at 4°C. Pellets were washed with 0.5 mL of 70% ethanol. The samples were vortexed and centrifuged at 7500xg for 5 minutes at 66 4°C. Supernatants were discarded, and the RNA pellets were dried and then dissolved in 20 μL RNase-free water and incubated at 55°C for 10 minutes. Reverse transcription was carried out with 1 μg RNA in molecular-grade water to a total volume of 6.2 μL for each condition. 0.8 μL DNase buffer solution and 1 μL DNase I enzyme solution were added, and digestion carried out at 37°C for 1 hour. 2 μL 25 mM EDTA was added, followed by incubation at 75°C for 10 minutes to deactivate the DNAse. 2 μL poly dT 23 was added and incubated at 65°C for 5 minutes. 10 μL ProtoScript II reaction mix (NEB) and 2 μL Protoscript II enzyme mix was added to the experimental samples, while 2 μL molecular grade water was added to the no reverse transcriptase controls. Samples were incubated at 42°C for 1 hour then 80°C for 5 minutes, and the cDNA products were stored at -20°C until use. 2.2.13 qPCR for TH1 and Treg lineage cytokines and transcription factors A reaction mix was prepared with 13 μL 2x Power SYBR Green mix (Thermo), 1.5 μL 10 μM forward primer, and 1.5 μL 10μM reverse primer for each well. 10 μL of ~2ng/μL cDNA was added to each well. The plate was sealed and run with run mode set to Standard 7500 and assay set to ddCt (Relative Quantification) Plate on an ABI Applied Biosystems 7500 Real-Time PCR System (Thermo). Cycle conditions were 50°C for 2 minutes, followed by 95°C for 10 minutes, followed by 40 cycles of 95°C for 15 seconds and 60°C for 1 minute. ROX was used as the passive reference, and 18S was used as the reference gene. Ct values provided by the 7500 Fast System Software program were used to calculate 2-ddCt. Primers for transcription factors (Tbet, Foxp3) and cytokines (Ifng, Il10) and 18S are in Table 2.3. 67 2.2.14 Statistical analyses All statistical analyses were performed using Prism 6 software. A Shapiro-Wilk’s test was used to confirm normality. Comparisons of two data sets were analyzed by unpaired t tests with Welch’s correction for unequal standard deviations. Comparisons of three or more data sets were analyzed by Two-way ANOVA with Tukey’s multiple comparisons test. Significance was defined as p<0.05. Statistically significant outliers from qPCR data were identified using GraphPad outlier calculator and excluded prior to normality testing. All data points were included for other experiments. P-values are summarized as * p<0.05, ** p<0.01, *** p<0.001, **** p<0.0001. Table 2.1 Characteristics of healthy female domestic short hair donor cats used in this study. FVRCP= feline viral rhinotracheitis, calicivirus, and panleukopenia. Donor # Sex Approximate age Vaccination Status 1 Male 1 year Rabies, FVRCP 2 Male 1 year Rabies, FVRCP 3 Male 1 year Rabies, FVRCP 4 Male 1 year Rabies, FVRCP 5 Female 2.5 years Rabies, FVRCP 6 Female 2.5 years Rabies, FVRCP Figure 2.1 Gating strategy for feline T cells. Cells were analyzed for FSC-A by LIVE/DEAD and gated on cells that excluded the viability dye. Cells were then analyzed for forward scatter area versus height to isolate single cells. Lastly, cells were analyzed for CD4 and CD8 expression. Quadrants for CD4 68 positive and CD8 positive cells were then analyzed for expression of CD134 and CellTrace Violet. FSC-A= forward scatter area; FSC-H= forward scatter height. Table 2.2 Dilutions of antibodies used for flow cytometry staining and CD3 MACS enrichment of T cells. Marker Conjugate Dilution Clone Manufacturer Feline CD4 FITC 1:10 vpg34 Bio-Rad Feline CD8 PE 1:100 fCD8 Southern Biotech Feline CD134 AlexaFluor 647 1:10 7D6 Bio-Rad Feline CD3 Unconjugated 1:16 (hybridoma) supernatant) NZM1 Dr. Yorihiro Nishimura Goat anti- mouse IgG3 AlexaFluor 488 1:200 Polyclonal Invitrogen Human CD271 BV421 1:20 C40-1457 BD Human CD19 FITC 1:20 HIB19 BioLegend Table 2.3 Forward and reverse primer sequences for used for quantitative PCR of TH1 and Treg lineage cytokines and transcription factors. Primer Sequence (5’ to 3’) Interferon-γ Forward GCCAAATTGTCTCCTTCTACCT Interferon-γ Reverse CCGTTTACTGGAGCTGGTATTT Tbet Forward ACCACCTGTTGTGGTCCAAGT Tbet Reverse ACCACGTCCACGAACATCCG IL-10 Forward CCTACTCAGGGATATGGGAGAA IL-10 Reverse AATGGGAGTTGAGGTATCAGAAG Foxp3 Forward CAACGAGATCTACCACTGGTTC Foxp3 Reverse TTGTGTAGGCTCAGGTTGTG 18S Forward AACTTTCGATGGTAGTCGCC 18S Reverse ATGTGGTAGCCGTTTCTCAGG 69 2.3 Results 2.3.1 ConA and PMA/I are potent stimuli for feline T cell proliferation and activation. We first isolated CD3+ T cells from PBMC collected from healthy feline donors. Prior to MACS isolation, CD3+ cells were 24.2%, 53.2%, and 37.3% from three donors, in line with previously reported frequencies detected with this antibody.18 Following MACS, purity increased to 98.7%, 97.6%, and 97.5%, respectively (Figure 2.2A). Human and canine primary T cells are conventionally activated and expanded with CD3/CD28 activating antibodies, 12,17,22,23 and although we obtained a feline CD3 antibody, feline CD28 antibodies are not commercially available. Thus, we tested alternative conditions previously demonstrated to expand T cells from other species, as well as feline T cells, which included IL-2, IL-21, concanavalin A (ConA), or phorbol myristate acetate with ionomycin (PMA/I).12,14,24,25 Cells from three donors were treated with either rfIL-2 or rfIL-2 with rhIL-21 maintained the highest viability, which was similar from 48-96 hours (rfIL-2 61.5-86.4%; rfIL-2 with rhIL-21 74.8- 86%) (Figure 2.1B). Cells treated with rfIL-2 plus ConA had an average viability of 79.3% for the first 48-72 hours but viability declined at 96 hours (41.6-58.4%) (Figure 2.2B). Conversely, viability of T cells cultured in rfIL-2 plus PMA/I was low at 48 hours but increased by the 96-hour timepoint (59.1-66.2%) (Figure 2.2B). We next measured T cell proliferation. Gating on CD4+ and CD8+ T cells, rfIL-2 did not induce proliferation of either subset, while the addition of rhIL-21 induced proliferation at 72 70 hours within a small subset of CD4+ and slightly larger subset of CD8+ T cells (Figure 2.2C). Figure 2.2 ConA and PMA/I are potent stimuli for feline T cell proliferation and activation. PBMCs from whole blood samples were stained with CellTrace Violet proliferation dye, and T cells were enriched by MACS for CD3 followed by flow cytometry analysis. (A) CD3 expression on PBMCs (pre) and enriched T cells (post) on Day 0, n=3 donors (B-D) Enriched T cells were incubated with rfIL- 2 alone or with rhIL-21, ConA, or PMA/I for 24 hours. Medium was exchanged to remove mitogenic stimuli and rfIL-2 (for rfIL-2 alone, ConA, and PMA/I) or rfIL-2 with rhIL-21 was added and cells were cultured for an additional three days. (B) Percent viable cells stained with LIVE/DEAD dye on Day 0 (untreated) or at each timepoint. Representative of n=3 donors (C) CellTrace Violet dilution in viable, single, CD4+ or CD8+ cells. Representative of n=3 donors (D) CD134 geometric MFI of viable, single, CD4+ or CD8+ cells. Mean ± SD n=3. Two-way ANOVA with Tukey’s multiple comparisons test was used to compare treatment conditions at each timepoint. * p<0.05, ***p<0.001, ****p<0.0001, ns, not significant. ConA= concanavalin A; MACS= magnetic activated cell sorting; MFI= mean fluorescence intensity; PMA/I= phorbol myristate acetate plus ionomycin; rfIL-2= recombinant feline IL-2; rhIL-21= recombinant human IL-21. 71 Treatment with rfIL-2 plus ConA or PMA/I resulted in at least one round of division by 72 hours with multiple rounds of division detected at 96 hours in both CD4+ and CD8+ populations (Figure 2.2C). To determine the level of activation conferred by each condition throughout the time course we measured expression of the T cell activation marker CD134, also known as OX40.26,27 rfIL-2 alone or with rhIL-21 yielded minimal CD134 expression in both CD4+ and CD8+ populations, whereas significantly higher expression was induced following exposure to ConA or PMA/I at 48 hours in both populations (Figure 2.2D). While CD134 expression remained relatively unchanged in rfIL-2 plus ConA throughout the 96-hour time course, rfIL-2 plus PMA/I treatment induced a time-dependent increase in CD134 expression in both subsets and resulted the highest overall expression in CD8+ cells (Figure 2.2D). Together, these results demonstrate the utility of using rfIL-2 in combination with ConA or PMA/I for expanding and activating feline T cells. 2.3.2 ConA and PMA/I combined with polarizing cytokines generates feline THelper subsets Next, we aimed to determine if we could replicate the conditions previously used with murine T cells to generate TH1 and Tregs,28 two CD4+ T cell subsets with major roles in controlling viral infections and autoimmunity, respectively, and that could be used to augment CAR T cell function in disease-specific contexts.29 We cultured CD3- enriched T cells in ConA or PMA/I in combination with rfIL-2 alone (TH0), rfIL-2 with recombinant feline IL-12 (TH1), or rfIL-2 with recombinant human TGF-b1 (rhTGF-b1, Treg) for six days. In TH1 polarizing cytokines with ConA treatment there 72 was minimal upregulation of the TH1 driver transcription factor Tbet, which was similar with PMA/I treatment (Figure 2.3A). ConA induced a slight increase in Foxp3, a driver transcription factor for Treg, in cells cultured with rhTGF-b1, but PMA/I induced almost 7.5-fold higher increase in expression relative to ConA (Figure 2.3A). These data contrast with a previous report where Foxp3 was upregulated in CD4+CD25- cells treated with ConA and rhTGF-b1,30 but are consistent with our observations that PMA/I induces more proliferation and activation of feline T cells. Importantly, TH1 polarizing conditions resulted in a marked increase in Ifng gene levels in cells cultured in either ConA or PMA/I. Again, the relative levels were around 4.5-fold higher in cells treated with PMA/I (Figure 2.3B). Treg conditions induced little change in Il10 gene expression for ConA treated cells while PMA/I treated cells had an average 18-fold induction in Il10 gene expression (Figure 2.3B). 73 Figure 2.3 Primary feline T cells polarized with T helper cytokine milieu upregulate lineage cytokine expression and secretion. Enriched primary feline T cells were stimulated with rfIL-2 and either ConA or PMA/I in combination with either rfIL-12 (TH1) or rhTGF-β1 (Treg) for 24 hours, then media was exchanged and cells cultured with rfIL-2 and either rfIL-12 or rhTGF-β1 for an additional 5 days. Cells were harvested on day 6, lysed with TRIzol reagent, reverse transcribed into cDNA and analyzed by qPCR for (A) lineage transcription factors or (B) lineage cytokines. Minimum to maximum with mean of technical replicates indicated from n=4-6 donors. Data were analyzed by unpaired t tests with Welch’s correction for unequal standard deviations comparing ConA to PMA/I. ns=not significant. Culture supernatant from each condition for each donor was harvested on day 6, pooled, and analyzed in triplicate for (C) IFN-γ or (D) IL-10 secretion (pg/mL). Each data point represents the mean of triplicate technical replicates from n=3 individual donors from two independent experiments. Data were analyzed by unpaired t tests with Welch’s correction for unequal standard deviations comparing TH0 to TH1 or Treg conditions, respectively. ns=not significant, * p<0.05. IFN-γ= interferon-γ; qPCR= quantitative PCR; rfIL-12= recombinant feline IL-12; rhTGF-β1= recombinant human TGF-β1. 74 We next tested whether these polarized subsets also secreted their respective lineage- associated cytokines. Both ConA and PMA/I resulted in marked secretion of interferon-g in the TH1 condition compared to the TH0 and Treg conditions, though the relative secretion level with PMA/I was 48-236-fold of that induced by ConA (Figure 2.3C). IL-10 secretion from cells in the Treg condition was similar with ConA and PMA/I, and the PMA/I, but not the ConA, Treg condition secreted much more IL-10 than the TH0 and TH1 conditions (Figure 2.3D). Thus, culture of primary feline T cells with recombinant feline IL-12 or rhTGF-b1 induced transcription factors and cytokines consistent with TH1 and Treg CD4+ subsets. 2.3.3 PMA/I yields greater ex vivo feline T cell expansion than ConA A critical aspect of cell-based immunotherapy is the ex vivo expansion of therapeutically relevant cell numbers for infusion into patients. Since PMA/I and ConA stimulated T cells had similar viability at 96 hours and similar proliferation profiles, we next asked which condition would result in greater overall T cell expansion using the G-Rex system. Seeding 1 million T cells per well and culturing with rfIL-2 and ConA resulted in expansion of up to 18 million cells within 12 days, while rfIL-2 and PMA/I yielded nearly double the number of cells (31 million) (Figure 2.4). Results were consistent across four independent donors where PMA/I led to a greater number of T cells. These data demonstrate the potential to expand primary feline T cells ex vivo into clinically relevant numbers and the comparatively better yield achieved with PMA/I. 75 Figure 2.4 PMA/I stimulation yields greater ex vivo expansion of primary feline T cells than ConA. 1x106 T cells were seeded in 1 mL per well of a G-Rex 24 well plate and stimulated with either rfIL-2 and ConA or PMA/I. At 24 hours, 7 additional mL of media with rfIL-2 was added and cells were counted on the indicated days. Two-way ANOVA with Tukey’s multiple comparisons test, n=4 donors was used to compare ConA and PMA/I at each timepoint. Lines connect data from the same donor. ns=not significant, * p<0.05, *** p<0.001. 2.3.4 Generation of functional primary feline CAR T cells Protocols to generate human CAR T cells using lentivirus have been well documented (reviewed in 31) and FIV-vectored lentiviral systems have been used to transduce feline cells originating from a variety of tissues, including bone marrow cells as well as a feline T cell line.20,32,33 We next tested whether a three-vector FIV lentiviral system could efficiently transduce primary feline T cells on day four of PMA/I expansion in the G-Rex plate to express a human CD19 CAR with CD28 and CD3z cytoplasmic domains (1928Z). 72 hours post transduction, there was a roughly 2:1 ratio of CD4 to CD8 T cells. We tracked transduction using the co-expressed truncated human nerve growth factor receptor (LNGFR) marker (Figure 2.5A). Compared to mock transduction with polybrene alone (Mock), transduction with 1928Z lentivirus resulted in an average of 60.4% LNGFR expression in CD4+ T cells and 68.2% in 76 CD8+ T cells, which was consistent across three independent donors (52.5-65.5% CD4+ and 51.7-77.2% CD8+) (Figure 2.5B). 77 Figure 2.5 Primary feline CAR T cells generated by lentiviral transduction. (A) Schematic of primary feline T cell expansion, transduction, and cytotoxicity assay. Enriched primary feline T cells were stimulated in a G-Rex 24 well plate with rfIL-2 and PMA/I for 24 hours in 1 mL total volume before diluting media to 8 mL with rfIL-2 for an additional 3 days. 1x106 T cells were transduced with either polybrene alone (Mock) or in combination with hCD19-28Z-LNGFR lentivirus (1928Z). Image prepared in BioRender. Cells were expanded in a G-Rex well before harvesting for (B) Flow cytometry analysis of transduced and expanded viable, single, CD4+ or CD8+ cells for LNGFR expression (transduction efficiency marker). (C) WT and CD19KO Raji cells were stained for CD19 and analyzed by flow cytometry. (D) 2x105 Mock transduced T cells or 1928Z feline CAR T cells were incubated with 2x104 WT or CD19KO target cells and cytotoxicity was measured after 4 hours by staining with LIVE/DEAD dye and analyzing by flow cytometry. Mean ± SD from n=3 donors. Two- way ANOVA with Tukey’s multiple comparisons test across conditions. * p<0.05, **** p<0.0001. CAR= chimeric antigen receptor; CD19KO= CD19 knockout; CMV= cytomegalovirus promoter; LNGFR= truncated nerve growth factor receptor; WT= wild type; RRE= Rev response element; WPRE= woodchuck hepatitis virus post-transcriptional regulatory element. We next tested whether the transduced feline CAR T cells were functional and antigen specific. We generated CD19 deficient Raji cells (CD19KO) (Figure 2.5C), which were used in parallel with CD19+ wild-type (WT) Raji cells as targets in a cytotoxicity assay. Mock transduced feline T cells demonstrated low feline anti-human xenogeneic activity with less than 10% cytotoxicity against WT or CD19KO targets (Figure 2.5D). 1928Z CAR T cells demonstrated significantly higher cytotoxicity against specific targets compared to Mock transduced T cells confirming that the CAR was functional. Moreover, 1928Z CAR T cells also had significantly higher cytotoxicity against specific targets (WT) compared to non-specific targets (CD19KO) demonstrating CAR specificity. 1928Z CAR T cells exhibited slightly higher activity towards non-specific targets compared to Mock transduced T cells, suggesting that there may be an elevated level of baseline activation. Together, these data demonstrate the generation of functional and specific feline CAR T cells. 78 2.4 Discussion This study describes the conditions for feline T cell expansion and engineering for use in chimeric antigen receptor (CAR) T cell immunotherapy. We successfully enriched primary T cells to >97% purity, activated them, and expanded them ex vivo. We consistently observed the greatest ex vivo expansion and activation using rfIL-2 plus PMA/I. We also describe a method to transduce expanded primary feline T cells with lentivirus to express a specific CAR. These feline CAR T cells demonstrated specific cytotoxicity against target cells. Although CAR T cell therapy has been most widely investigated to treat cancers, a growing interest has developed in repurposing it for other diseases (reviewed in 34) Multiple groups have reported preclinical studies using CAR T cells to treat viral infections such as HIV, hepatitis C, and SARS-CoV-2.5–8 CD19 CAR T cells have also been utilized to eliminate autoreactive B cells in human patients with systemic lupus erythematosus.2–4 CAR T therapy for both viral infection and autoimmunity could be enhanced by taking advantage of the natural function of TH1 or Treg phenotypes, respectively. We showed that after six days with ConA or PMA/I plus polarizing cytokines, feline T cell cultures upregulated expression of the respective lineage transcription factors and cytokines and secreted those cytokines. Although culturing in TH1 cytokines, rfIL-2 plus recombinant feline IL-12, slightly increased Tbet expression, these cytokines induced a larger increase in Ifng expression, which was higher with PMA/I than ConA. The disconnect in lineage transcription factor and 79 cytokine expression could be due to the harvest timepoint, as it is possible that Tbet expression is upregulated early then decreases back to basal levels before day 6. Importantly, the upregulation of Ifng correlated with cytokine secretion. The differences in polarization between ConA and PMA/I stimulation could be attributed to the fact that PMA/I confers both signal 1 (T cell receptor signaling) and signal 2 (co-stimulation), whereas ConA only confers signal 1. ConA induced nearly equal to higher IL-10 secretion in the TH1 condition compared to the Treg condition, which consisted of rfIL-2 plus rhTGF-b1. This could be indicative of the T cells receiving pro-inflammatory signal 1 and signal 3 (cytokine stimulation) without signal 2, as PMA/I stimulation resulted in greater upregulation of Il10 and Foxp3 and secretion of IL-10. Although the individual levels of cytokine produced was variable, the trends of secretion between polarizing conditions were consistent between donors. Of note, our polarizing cultures also contained CD8+ T cells, which might also respond to the polarizing cytokines and have an impact on CD4+ T cell differentiation. Future studies could replicate our experiments by first isolating CD4+ T cells. However, the polarized cells would then have to be characterized for lineage-specific gene signatures at the single cell level, lineage markers by flow cytometry, or in vitro functional validation to confirm polarization. Our difference in culture conditions might explain the discrepancy in our ConA Treg polarization condition results compared to a previous study that stimulated sorted CD4+CD25- cells with ConA and rhTGF-b1, and observed marked upregulation of Foxp3 as well as suppressor function in vitro.30 That study also utilized a higher rhTGF-b1 dose (10 ng/mL) compared to ours (2 ng/mL). 80 Nonetheless, our results demonstrate that primary feline T cells can be polarized into pro-inflammatory or regulatory subsets to a higher degree with PMA/I than ConA. To generate a cell-based immunotherapy, the cells must be expanded ex vivo into clinically relevant numbers. One expansion platform that has been widely adopted in academia and industry is the G-Rex system, which promotes maximum cell growth through enhanced gas exchange. We found that rfIL-2 plus PMA/I resulted in up to 30-fold expansion by day 12 (Figure 3, 4 donors), while rfIL-2 plus ConA led to up to 18-fold expansion. These data are consistent with a previous study showing that PMA/I treated cells had a higher stimulation index compared to ConA treated cells.25 Another study noted that PMA/I failed to induce feline T cell stimulation compared to ConA, but this could be attributed to toxicity from the high dose of PMA used in that study (10-15 mg/mL compared to 25 ng/ml in our study).24 The results of the initial proliferation experiments along with the ex vivo expansion data reveal that increasing the potency of a stimulus increased leads to increased proliferation and total cell number but also results in increased cell death, as seen with PMA/I. One explanation for this could be that while many of the cells are dying, the population of cells most responsive to the stimulation are proliferating faster than the rate of cell death and thus increasing the total number of both viable and non-viable cells. Our cells remained viable during expansion, could be genetically engineered to express a CAR, and retained function. 81 Though protocols for CAR T cell generation have been established for human and, more recently canine, none have been published to date for feline. CAR T cells are typically generated through transduction with g-retrovirus or lentivirus encoding for the CAR and any transduction markers (reviewed in 9). Previous studies have reported success using FIV vectors to transduce feline cell lines and primary cells.20,32,33 Although cells from many different tissues, including a feline T cell line, were successfully transduced, none of the studies reported transduction of enriched primary feline T cells. Here, we transduced primary T cells with an FIV-based lentivirus encoding a human CD19 CAR and truncated human nerve growth factor receptor transduction marker and observed efficient transduction of both CD4+ and CD8+ T cell populations. Although these transgenes are under the control of a cytomegalovirus immediate early enhancer/promoter that has been reported to have poor function in feline cells transduced with lentivirus,33 we observed surface expression of truncated nerve growth factor receptor in transduced cells and cytotoxicity by CAR expressing cells against specific target cells. Reduced cytomegalovirus promoter activity in T cells may occur due to silencing over time,35,36 thus future development may include using a different promoter for CAR expression in primary feline T cells. The CF1DEnv packaging vector20 we used to generate lentivirus encodes FIV vif in addition to the necessary gag, pol, and rev elements. FIV vif has been shown to degrade feline APOBEC3, a host restriction factor to lentivirus infection.37,38 Future studies would need to compare transduction with lentiviruses packaged with and without vif to determine its importance in transducing feline T cells. In our hands, feline CAR T cells demonstrated significant cytotoxicity towards specific target cells 82 compared to mock-transduced T cells. This demonstrates that human signaling domains are functional in feline T cells. We also observed low but significant CAR T cell killing of non-specific targets as compared to mock-transduced T cells. This non- specific activity was significantly less than CAR T cell killing of specific target cells. The non-specific killing by CAR T cells may be due to the elevated activation state imparted by tonic CD28 signaling emanating from the CAR. Future studies should include developing a fully feline CAR with alternative costimulatory domains to reduce background signaling and potential rejection in vivo in immune competent cats. Here we provide a proof-of-concept for generating functional primary feline CAR T cells. To fully capitalize on feline CAR T therapy for specific diseases, additional work is needed to generate monoclonal antibodies towards target antigens and develop corresponding single chain variable fragments. Human T cell activation and expansion for clinical use is most often induced by CD3/CD28 activation beads, so to develop good manufacturing practice-grade feline CAR T cells, similar feline-specific activation beads will also need to be developed and validated. Despite these limitations, our study provides the first step in advancing feline immunotherapy to improve the health of our feline companions. 83 REFERENCES 1. United States Food and Drug Administration. Approved cellular and gene therapy products. April 26, 2024. https://www.fda.gov/vaccines-blood- biologics/cellular-gene-therapy-products/approved-cellular-and-gene-therapy- products 2. Krickau T, Naumann-Bartsch N, Aigner M, et al. CAR T-cell therapy rescues adolescent with rapidly progressive lupus nephritis from haemodialysis. The Lancet. 2024;403(10437):1627-1630. doi:10.1016/S0140-6736(24)00424-0 3. Wang W, He S, Zhang W, et al. BCMA-CD19 compound CAR T cells for systemic lupus erythematosus: a phase 1 open-label clinical trial. Ann Rheum Dis. Published online May 22, 2024:ard-2024-225785. doi:10.1136/ard-2024-225785 4. Mackensen A, Müller F, Mougiakakos D, et al. Anti-CD19 CAR T cell therapy for refractory systemic lupus erythematosus. Nat Med. 2022;28(10):2124-2132. doi:10.1038/s41591-022-02017-5 5. Guo X, Kazanova A, Thurmond S, Saragovi HU, Rudd CE. Effective chimeric antigen receptor T cells against SARS-CoV-2. iScience. 2021;24(11):103295. doi:10.1016/j.isci.2021.103295 6. Maldini CR, Claiborne DT, Okawa K, et al. Dual CD4-based CAR T cells with distinct costimulatory domains mitigate HIV pathogenesis in vivo. Nat Med. 2020;26(11):1776-1787. doi:10.1038/s41591-020-1039-5 84 7. Anthony-Gonda K, Bardhi A, Ray A, et al. Multispecific anti-HIV duoCAR-T cells display broad in vitro antiviral activity and potent in vivo elimination of HIV-infected cells in a humanized mouse model. Sci Transl Med. 2019;11(504):eaav5685. doi:10.1126/scitranslmed.aav5685 8. Sautto GA, Wisskirchen K, Clementi N, et al. Chimeric antigen receptor (CAR)- engineered T cells redirected against hepatitis C virus (HCV) E2 glycoprotein. Gut. 2016;65(3):512-523. doi:10.1136/gutjnl-2014-308316 9. Levine BL. Performance-enhancing drugs: design and production of redirected chimeric antigen receptor (CAR) T cells. Cancer Gene Ther. 2015;22(2):79-84. doi:10.1038/cgt.2015.5 10. Guedan S, Calderon H, Posey AD, Maus MV. Engineering and design of chimeric antigen receptors. Mol Ther Meth Clin Dev. 2019;12:145-156. doi:10.1016/j.omtm.2018.12.009 11. Sadelain M, Brentjens R, Rivière I. The basic principles of chimeric antigen receptor design. Cancer Discov. 2013;3(4):388-398. doi:10.1158/2159-8290.CD- 12-0548 12. Panjwani MK, Smith JB, Schutsky K, et al. Feasibility and safety of RNA- transfected CD20-specific chimeric antigen receptor T Cells in dogs with spontaneous B cell lymphoma. Mol Ther. 2016;24(9):1602-1614. doi:10.1038/mt.2016.146 85 13. Sakai O, Igase M, Mizuno T. Optimization of canine CD20 chimeric antigen receptor T cell manufacturing and in vitro cytotoxic activity against B‐cell lymphoma. Vet Comp Oncol. 2020;18(4):739-752. doi:10.1111/vco.12602 14. Panjwani MK, Atherton MJ, MaloneyHuss MA, et al. Establishing a model system for evaluating CAR T cell therapy using dogs with spontaneous diffuse large B cell lymphoma. Oncoimmunology. 2020;9(1):1676615. doi:10.1080/2162402X.2019.1676615 15. Sakai O, Yamamoto H, Igase M, Mizuno T. Optimization of culture conditions for the generation of canine CD20-CAR-T cells for adoptive immunotherapy. In Vivo. 2022;36(2):764-772. doi:10.21873/invivo.12763 16. Zhang S, Black RG, Kohli K, et al. B7-H3 Specific CAR T cells for the naturally occurring, spontaneous canine sarcoma model. Mol Cancer Ther. 2022;21(6):999-1009. doi:10.1158/1535-7163.MCT-21-0726 17. Yin Y, Boesteanu AC, Binder ZA, et al. Checkpoint blockade reverses anergy in IL-13Rα2 humanized scFv-based CAR T cells to treat murine and canine gliomas. Mol Ther Oncolytics. 2018;11:20-38. doi:10.1016/j.omto.2018.08.002 18. Nishimura Y, Shimojima M, Sato E, et al. Downmodulation of CD3 epsilon expression in CD8 alpha+beta- T cells of feline immunodeficiency virus-infected cats. J Gen Virol. 2004;85(Pt 9):2585-2589. doi:10.1099/vir.0.80102-0 19. Zhao Z, Condomines M, van der Stegen SJC, et al. Structural design of engineered costimulation determines tumor rejection kinetics and persistence of CAR T Cells. Cancer Cell. 2015;28(4):415-428. doi:10.1016/j.ccell.2015.09.004 86 20. Poeschla EM, Wong-Staal F, Looney DJ. Efficient transduction of nondividing human cells by feline immunodeficiency virus lentiviral vectors. Nat Med. 1998;4(3):354-357. doi:10.1038/nm0398-354 21. Saenz DT, Barraza R, Loewen N, Teo W, Poeschla EM. Titration of feline immunodeficiency virus-based lentiviral vector preparations. Cold Spring Harb Protoc. 2012;2012(1):pdb.prot067561. doi:10.1101/pdb.prot067561 22. Rotolo A, Atherton MJ, Kasper BT, Haran KP, Mason NJ. Genetic re-direction of canine primary T cells for clinical trial use in pet dogs with spontaneous cancer. STAR Protocols. 2021;2(4):100905. doi:10.1016/j.xpro.2021.100905 23. Gagliardi C, Khalil M, Foster AE. Streamlined production of genetically modified T cells with activation, transduction and expansion in closed-system G-Rex bioreactors. Cytotherapy. 2019;21(12):1246-1257. doi:10.1016/j.jcyt.2019.10.006 24. Cridge H, Kordon A, Pinchuk LM, et al. Effects of cyclosporine on feline lymphocytes activated in vitro. Vet Immunol Immunopathol 2020;219:109962. doi:10.1016/j.vetimm.2019.109962 25. Aronson LR, Drobatz KJ, Hunter CA, Mason N. Effects of CD28 blockade on subsets of naïve T cells in cats. AJVR. 2005;66(3):483-492. doi:10.2460/ajvr.2005.66.483 26. Shimojima M, Miyazawa T, Ikeda Y, et al. Use of CD134 as a primary receptor by the feline immunodeficiency virus. Science. 2004;303(5661):1192-1195. doi:10.1126/science.1092124 87 27. Mallett S, Fossum S, Barclay AN. Characterization of the MRC OX40 antigen of activated CD4 positive T lymphocytes--a molecule related to nerve growth factor receptor. The EMBO Journal. 1990;9(4):1063-1068. doi:10.1002/j.1460- 2075.1990.tb08211.x 28. Sekiya T, Yoshimura A. In vitro Th differentiation protocol. In: Feng XH, Xu P, Lin X, eds. TGF-β Signaling. Vol 1344. Methods in Molecular Biology. Springer New York; 2016:183-191. doi:10.1007/978-1-4939-2966-5_10 29. Fung VCW, Rosado-Sánchez I, Levings MK. Transduction of human T cell subsets with lentivirus. In: Annunziato F, Maggi L, Mazzoni A, eds. T-Helper Cells. Vol 2285. Methods in Molecular Biology. Springer US; 2021:227-254. doi:10.1007/978-1-0716-1311-5_19 30. Petty CS, Tompkins MB, Tompkins WA. Transforming Growth Factor- β/Transforming Growth Factor-βRII signaling may regulate CD4+CD25+ T- regulatory cell homeostasis and suppressor function in feline AIDS lentivirus infection. J Acquir Immune Defic Syndr. 2008;47(2):148-160. doi:10.1097/QAI.0b013e318160df70 31. Labbé RP, Vessillier S, Rafiq QA. Lentiviral vectors for T cell engineering: clinical applications, bioprocessing and future perspectives. Viruses. 2021;13(8):1528. doi:10.3390/v13081528 32. Curran MA, Kaiser SM, Achacoso PL, Nolan GP. Efficient transduction of nondividing cells by optimized feline immunodeficiency virus vectors. Mol Ther. 2000;1(1):31-38. doi:10.1006/mthe.1999.0007 88 33. Price MA, Case SS, Carbonaro DA, et al. Expression from second-generation feline immunodeficiency virus vectors is impaired in human hematopoietic cells. Mol Ther. 2002;6(5):645-652. doi:10.1006/mthe.2002.0725 34. Maldini CR, Ellis GI, Riley JL. CAR T cells for infection, autoimmunity and allotransplantation. Nat Rev Immunol. 2018;18(10):605-616. doi:10.1038/s41577-018-0042-2 35. Milone MC, Fish JD, Carpenito C, et al. Chimeric receptors containing CD137 signal transduction domains mediate enhanced survival of T cells and increased antileukemic efficacy in vivo. Mol Ther. 2009;17(8):1453-1464. doi:10.1038/mt.2009.83 36. Jones S, Peng PD, Yang S, et al. Lentiviral vector design for optimal T cell receptor gene expression in the transduction of peripheral blood lymphocytes and tumor-infiltrating lymphocytes. Hum Gene Ther. 2009;20(6):630-640. doi:10.1089/hum.2008.048 37. Yoshikawa R, Takeuchi JS, Yamada E, et al. Feline immunodeficiency virus evolutionarily acquires two proteins, vif and protease, capable of antagonizing feline APOBEC3. J Virol. 2017;91(11):e00250-17. doi:10.1128/JVI.00250-17 38. Troyer RM, Thompson J, Elder JH, VandeWoude S. Accessory genes confer a high replication rate to virulent feline immunodeficiency virus. J Virol. 2013;87(14):7940-7951. doi:10.1128/JVI.00752-13 89 CHAPTER 3 Design of chimeric antigen receptor T cells to treat feline infectious peritonitis James R. Cockey, BS; Gavin M. Zhou, Annette Choi, BS; Matthew P. DeLisa, MS, PhD; Gary R. Whittaker, PhD; Cynthia Leifer, PhD Contributions: JRC, MPD, GRW, and CAL conceived the study. JRC performed all lenvitiral transduction, flow cytometry, and western blotting. JRC and GMZ cloned plasmids. GMZ designed felinized sequences. JRC and AC performed live infectionexperiments.. JRC and CAL wrote the manuscript. 90 Abstract Feline infectious peritonitis virus (FIP) is a deadly disease in cats caused by infection with a mutated form of feline coronavirus (FCoV). While a nucleoside analog has recently proven to be an effective treatment in most patients, there are several patients that remain refractory, or relapse, thus necessitating an alternative treatment modality. Chimeric antigen receptor (CAR) T cell therapy is a type of cell-based immunotherapy that involves harvesting a patient’s immune cells, engineering them to express a CAR targeting a desired surface protein, and infusing them at a clinical dose. This treatment modality has seen dramatic success in treating hematological malignancies in humans and has since garnered interest for use as an antiviral. Here we propose repurposing CAR T cell therapy to target the spike protein of FCoV. We demonstrate that two anti- spike CAR constructs incorporating either CD28 or 4-1BB costimulatory domains are specific towards spike and confer an activation signal both in the presence of transfected spike as well as FCoV-infected cells. Thus, CAR T cell therapy represents a promising alternative modality to treat the subset of relapsed or refractory FIP patients. 3.1 Introduction FCoV is a virus infects cats and generally causes subclinical infection.1 FCoV is composed of two biotypes, feline enteric coronavirus (FECV), and FIP virus (FIPV). FIPV develops in about 5% of cats due to mutations in the spike gene occurring within 91 the host, resulting in acquired monocyte/macrophage tropism, systemic viral dissemination, and development of the more virulent biotype, FIPV. Mutation to FIPV then leads to the near universally fatal disease FIP.1 FIP can manifest clinically in a dry/non-effusive form presenting with neurological and/or ocular symptoms, or a wet/effusive form characterized by vasculitis and development of ascites, for which the disease derives its name.2 There are also two serotypes of the virus, Type I and Type II. Type I accounts for the majority of clinical cases but does not propagate efficiently in culture.3 Type II readily infects cells in culture and thus has been the focus of most in vitro FIPV studies.3 There remains no approved therapeutics for FIP in the United States, and thus treatment is focused on symptom management. Clinical trials of experimentally- infected and client-owned cats testing the nucleoside analog GS-441524 have demonstrated promise,4–7 and the United States Food and Drug Administration (FDA) has published a position on use of compounded GS-441524 in certain circumstances.8 However, not all cats treated with GS-441524 respond, and among those that do respond, approximately 12-31% may relapse after finishing the regimen and require a second or even third course of the drug.4,5,7 Moreover, the treatment course is generally 84 days,6,7 which carries a high risk of owner non-compliance and thus the possibility of antiviral resistance arising. Thus, investigation of alternative treatment modalities is still needed. 92 CAR T cell therapy is a cell-based immunotherapy that involves harvesting and genetically modifying T cells ex vivo to acquire major histocompatibility complex- independent specificity towards a protein expressed on the surface of target cells, and infusing them into the patient.9–11 The CAR consists of an single chain variable fragment (ScFv) derived from the variable light (VL) and variable heavy (VH) portions of a monoclonal antibody that serves as the antigen-binding domain, anchored on the cell surface to transmembrane and cytoplasmic signaling domains.12 The antigen specificity and activation conferred through the CAR allows for targeting of any desired surface protein, bypassing the normal T cell receptor/antigen presentation pathway. The success of CAR T therapy in treating human hematological malignancies has resulted in FDA approval of seven CAR T cell therapies,13 and has attracted interest in applying this modality within veterinary medicine. Previous studies have demonstrated methods of canine T cell activation and expansion using methods such as CD3/CD28 activation beads, mitogenic stimuli, or artificial antigen presenting cells; and induction of CAR expression has been achieved through mRNA electroporation and viral transduction.14–17 While the vast majority of the CAR T cell research in veterinary medicine has focused on application towards treating canine lymphoma or solid tumors, we previously demonstrated that feline T cells can be activated and expanded with mitogenic stimuli and demonstrate effector function when transduced to express a human CD19 CAR.18 Although these studies have mainly explored in the context of cancer treatment, CAR T therapy has recently been investigated for use as an antiviral.19–22 93 Here we show that a monoclonal antibody (clone 18A7.4) developed against FIPV spike detected surface Type II spike.23,24 We cloned the variable light (VL) and variable heavy (VH) genes of 18A7.4, and generated two CARs with either CD28 or 4- 1BB costimulatory domains. Both CARs were specific for Type II spike and T cells expressing the CARs were functional when co-incubated with either Type II spike transfected cells or FIPV infected cells. Thus, we demonstrate the development of an FIP-spike-directed CAR that can be further developed as a novel therapy for FIP. Our studies are the first-in-feline development of a CAR, and our approach could be used to develop new therapies for other feline diseases such as lymphoma. 3.2 Methods 3.2.1 Cell line culture HEK293T cells (H. Aguilar-Carreno, Cornell) and Jurkat T cells (R. Cerione, Cornell) were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM, Corning) or RPMI 1640 (Corning), respectively, supplemented with 10% fetal bovine serum (FBS, Avantor Seradigm), 2 mM L-glutamine (Corning), 1% penicillin-streptomycin (Corning), 2.5 µg/mL amphotericin B (Gibco), 1 mM sodium pyruvate (Corning), and 10 mM HEPES [(Corning), complete DMEM and complete RPMI, respectively]. Fcwf-4CU cells (E. Dubovi, Cornell) were cultured in Eagle’s Minimum Essential Medium (Corning) supplemented with 10% FBS, 10% Nu-Serum IV culture supplement (Corning), 1% penicillin-streptomycin, 2.5 µg/mL amphotericin B, and 10 94 mM HEPES (complete EMEM). Cell lines tested negative for mycoplasma using the Mycoplasma Detection Kit (Southern Biotech). 3.2.2 Hybridoma cell culture and antibody purification Anti-FIPV spike hybridoma 18A7.4 (E. Dubovi, Cornell) originally generated by Dr. Fred Scott23,24 was cultured in Hybridoma serum free media (SFM, Gibco) supplemented with 10% FBS, 1% penicillin-streptomycin, and 2.5 µg/mL amphotericin B. For antibody purification, FBS concentration in the media was gradually tapered down to 0% over four consecutive daily passages. Cells were expanded in 15 cm tissue culture plates, pelleted at 500xg, and supernatant was sterilized through a 0.2 µm filter. 18A7.4 IgG2a antibody was purified from filtered serum-free supernatant using HiTrap Protein G affinity columns by fast protein liquid chromatography and concentrated by spinning the antibody solution on an Amicon Ultra 15-30 kD centrifugal unit (Millipore). Final antibody concentration was determined by using Pierce BCA Protein Assay kit (Thermo) according to manufacturer’s instructions. 3.2.3 HEK293T transfection 5x105 HEK293T cells were seeded into 6 well plates in 2 mL of complete DMEM without antibiotics. A Cells were transfected 6 hours later using FUGENE HD (Promega). Briefly, 2.5 µg endotoxin-free plasmid DNA (Qiagen) was added to 492.5 95 µL OptiMEM (Gibco) followed by 7.5 µL, mixed, and incubated for 15 minutes at room temperature before adding dropwise to cells. 3.2.4 Surface and intracellular FCoV spike staining Two days post-transfection, HEK293T cells were detached with 1X Dulbecco’s phosphate buffered saline (DPBS) + 20 mM EDTA and aliquoted to 5 mL polystyrene tubes for unstained control, surface, or intracellular stains. Cells were stained with LIVE/DEAD Near IR in 1X DPBS for 30 minutes at 4°C to assess viability. Following a 2000xg spin for two minutes at 4°C to remove the dye, cells were divided for intracellular and surface staining. Cells for intracellular staining were permeabilized in 250 µL/tube Cytofix/Cytoperm solution (BD) for 15 minutes 4°C, washed twice with 1X perm/wash buffer (BD), and resuspended in 70 µL perm/wash buffer. For surface staining cells were washed once with flow cytometry buffer (1X DPBS + 1% bovine serum albumin (BSA, Roche) + 1 mM EDTA + 0.1% NaNH3) and resuspended in 70 µL flow cytometry buffer. All samples received 5µL/tube Human TruStain FcX (BioLegend) followed by 1:100 of spike monoclonal antibody 18A7.4 or C9 tag antibody (clone 1D4, Abcam). After one hour at 4°C, cells were washed twice with the respective wash buffers and incubated with 1:200 AlexaFluor 647 goat anti-mouse IgG H+L (Invitrogen) for 30 minutes at 4°C. Following two additional washes, all cells were resuspended in 500 µL/tube flow cytometry buffer. Viable, 96 single cells were assayed on a FACS Canto II (BD). Data were analyzed using FlowJo v10.6.2 software (BD). 3.2.5 Western blotting Transfected HEK293T cells were lysed at 48 hours in 200 µL lysis buffer (137 mM NaCl + 20 mM Tris HCl + 1 mM EDTA + 0.5/% Triton X-100 + H2O to pH 7.4) with 1X protease inhibitor cocktail (Halt) and1X PMSF (Sigma) added fresh. Lysates were incubated on ice for 30 minutes. An aliquot was taken to measure concentration, and 150 µL of lysate was combined with 30 µL of 6X reduced loading dye incubated at 95°C for 5 minutes and briefly spun down. Protein concentration was calculated using the Pierce BCA Protein Assay kit and even amounts of protein per condition were run on an acrylamide gel. Gels were transferred to nitrocellulose, blocked in Tris-buffered saline + 0.1% polyoxyethylene 20 sorbitan monolaurate (TBST) + 4% BSA and immunoblotted with 1.9 µg/mL18A7.4, 1 µg/mL anti-FLAG (clone M2, Sigma) or 1 µg/mL anti-C9 in TBST + 4% BSA overnight at 4°C. Blots were washed and incubated with 0.08 µg/mL goat-anti mouse IgG HRP secondary antibody (Thermo) in TBST + 4% nonfat dry milk. Blots were developed using Pierce ECL Western blotting Substrate (Thermo) and imaged on a ChemiDoc MP Imaging System (Bio-Rad). Blots were stripped and re-probed with 0.25 µg/mL anti-a-tubulin (clone DM1A, Invitrogen) and ***0.08 µg/mL goat anti-mouse IgG HRP secondary antibody. 97 3.2.6 Hybridoma RNA isolation, reverse transcription, and cDNA synthesis 18A7.4 hybridoma cells were pelleted for 5 minutes at 400xg and lysed in 750 µL TRIzol reagent (Ambion) before storing at -80°C until RNA isolation. The homogenate was thawed at room temperature, mixed with 150 µL chloroform, centrifuged at 11,400 RPM at 4°C, and the upper-layer aqueous phase was extracted. The aqueous phase was combined with 1 µg GlycoBlue (Ambion) and 375 µL isopropanol, incubated for 10 minutes at 4°C, and spun again 11,400 RPM for 10minutes. The RNA pellet was washed with 75% ethanol and resuspended in molecular-grade water. cDNA synthesis was carried out using 1 µg RNA and the Protoscript II First Strand cDNA synthesis kit (NEB) according to the manufacturer’s instructions. 3.2.7 18A7.4 VL and VH cloning and sequencing Degenerate forward and reverse primer mixes for murine variable light (VL) and heavy (VH) chains were utilized as described by Krebber et al.25 Independent PCRs were set up for the VL and VH using cDNA from 18A7.4 using Pfu Ultra II HS Fusion polymerase (Agilent) according to the manufacturer’s instructions. Thermocycler conditions were as follows: 95°C for 3 minutes, 6 cycles (95°C 30 seconds, 50°C 30 seconds, 72°C 60 seconds), 6 cycles (95°C 30 seconds, 55°C 30 seconds, 72°C 60 seconds), 30 cycles (95°C 30 seconds, 63°C 30 seconds, 72°C 60 seconds) and 72°C for 7 minutes. An aliquot of the PCR reaction was run on a 1% agarose gel to confirm ~400 bp size, and fragments were purified with a QiaQuick PCR purification kit (Qiagen). A second PCR reaction using forward and reverse primers with homology to 98 the degenerate primer ends and overhangs incorporating restriction sites to add a 5’ AflII site and 3’ XbaI site was carried out with the following thermal cycler conditions: 95°C for 2 minutes, 11 cycles (95°C 20 seconds, 67°C-1°C/cycle 20 seconds, 72°C 30 seconds), 19 cycles (95°C 20 seconds, 56°C 20 seconds, 72°C 30 seconds), and 72°C for 3 minutes. Product sizes were confirmed and purified as described above (primers listed in Table 1). The VL fragment and pFUSB5 from the Golden Gate TALEN and TAL effector kit 2.0 (Addgene #1000000024) were digested with AflII (NEB) and XbaI (NEB), gel extracted using the GeneJET Gel extraction kit (Thermo), and ligated using quick ligase (NEB) and 10X T4 ligase buffer (NEB) overnight at 16°C. The VH fragment was A-tailed by with Taq polymerase (Invitrogen) at 72°C for 20 minutes and ligated into pGEM-T Easy vector (Promega) following manufacturer instructions. Sanger sequencing was performed by the Cornell Institute of Biotechnology Genomics Core facility (RRID:SCR_021727), and sequencing results were analyzed using IgBlast (https://www.ncbi.nlm.nih.gov/igblast/). Table 3.1. Forward and reverse primers used in second PCR reaction to attach sites for AflII and XbaI (bold) to the PCR fragments encoding the VL and VH regions of anti-spike clone 18A7.4. PCR= polymerase chain reaction; VH= variable heavy chain, VL= variable light chain. Primer Sequence (5’ to 3’) VL_F3 CAAATACTTAAGGCCATGGCGGACTAC VL_R3 CAAAATTCTAGAGGAGCCGCCGCC VH_F3 CATTTACTTAAGGGCGGCGGCGG VH_R3 CATTTTTCTAGAGGAATTCGGCCCCCG 99 3.2.8 Generation of an 18A7.4 anti-spike CAR Anti-spike ScFv was designed using Geneious 6.1.4 software by using a 3X FLAG tag on the 5’ end of the 18A7.4 VL sequence, a Whitlow 218 linker sequence between the VL and VH, and amino acids 137-181 of human CD8a on the 3’ end of the VH. A BbsI NEB) restriction site was included at the 5’ end of the 3X FLAG and 3’ end of the hinge sequence as described by Bloemberg et al.26 The full sequence was ordered as a gene fragment (Azenta Life Sciences), digested with BbsI and cloned into pSLCAR- CD19-28Z (Addgene #135991) and pSLCAR-CD19-BBZ (Addgene #135992) where the CD19 was removed by digestion with BbsI-HF. Clones were confirmed for sequence and orientation (Plasmidsaurus). 3.2.9 Lentiviral production and Jurkat transduction The day before transfection, 2.5x106 HEK293T cells per plate were seeded onto duplicate 10 cm tissue culture plates. The next day, medium was exchanged to 8.8 mL per plate complete DMEM without antibiotics two hours prior to transfection. 20 µg of pSLCAR-CD19-BBZ, pSLCAR-18A7.4-28Z, or pSLCAR-18A7.4-BBZ were mixed with 1 µg HDM-Tat1b, 1 µg Rc-CMV-Rev, 1 µg HDM-Hgpm2 (G. Mostoslavsky, Boston University), and 2 µg pLTR-RD114A (Addgene plasmid# 17576) in 1.1 mL of Opti-MEM (Gibco) in duplicate and mixed by pipetting. 75 µL of FUGENE HD (Promega) was added to each mixture and incubated for 15 minutes at room temperature before adding dropwise to each plate of cells. Media was exchanged 24 hours later. Supernatant was collected at 48 and 72 hours, spun at 2000xg for 10 100 minutes at 4°C and clarified through a 0.45 µm PES syringe filter (Nest Scientific). Clarified supernatant was pooled at 72 hours in an ultracentrifuge tube (Beckman Coulter) and concentrated at 100,000xg for 90 minutes at 4°C in an Optima XPN-80 ultracentrifuge (Beckman Coulter) using an SW32 Ti rotor. Virus pellet was then dissolved in 500 µL basal RPMI 1640 without additives. 10 µL of 1 mg/mL Vectofusin-1 (Miltenyi Biotec) was added to a separate tube containing 490 µL basal RPMI and the two tubes were combined for virus resuspended in basal RPMI with a final concentration of 10 µg/mL Vectofusin-1. 2x106 Jurkat cells were resuspended in the virus/Vectofusin mixture and transferred to a 12 well tissue culture plate. Cells were spinoculated at 400xg for two hours at 32°C then placed in the 37°C with 5% CO2 incubator for another two hours before adding 1 mL complete RPMI and incubating overnight. Complete RPMI was exchanged the following day. Cells were enriched for surface CAR expression through magnetic activated cell sorting by incubating with anti-FLAG clone M2 followed by anti-mouse IgG Microbeads (Miltenyi), then running cells through an MS column (Miltenyi). 3.2.10 CAR Jurkat CD69 co-incubation assay HEK293T cells were transfected as described above. Two days later, Raji cells and transfected HEK293T cells were harvested and 1x105 per well were aliquoted in triplicate to a 96 well flat bottom plate. 2x105 wild type (WT) or CAR Jurkat cells per well were added in triplicate in a total volume of 200 µl per well complete RPMI and cells were-co-incubated for approximately 24 hours. The following day, cells were transferred to a 96-well round bottom plate. Cells were spun for 5 minutes at 400xg at 101 4°C, washed with flow cytometry buffer (1X DPBS + 1% bovine serum albumin (Roche) + 0.1% NaNH3 + 1 mM EDTA) then stained with anti-human CD69 APC (clone FN50, BD) for 30 minutes at 4°C. Cells were washed, fixed for 5minutes at 4°C in Cytofix/Cytoperm solution (BD), washed, resuspended in flow cytometry buffer, and 20,000 single cell events were collected on an Attune NxT CytKick Max Autosampler (Thermo). Data was analyzed using FlowJo v10.6.2 software. 3.2.11 FCoV production FCoV 79-1146 and FCoV 79-1683 (isolated by N. Pedersen, UC Davis) were propagated in Fcwf-CU cells grown in T175 flasks. When the cells reached approximately 90% confluency, they were washed once with basal EMEM (Corning) and infected with 4 ml of a 1/1000 dilution of virus in EMEM. The cells were incubated at 37°C with 5% CO₂ for 1 hour, with gentle shaking every 10 minutes. One-hour post-infection, 14 ml of EMEM supplemented with 10% heat-inactivated FBS (R&D Systems), 10% Nu-Serum, and 1% HEPES (Corning) was added. When a 70–80% cytopathic effect was observed, the supernatant was collected, centrifuged at 1000xg for 10 minutes, and aliquoted at -80°C. 3.2.12 Plaque assay to determine FCoV titer The titers of FCoV 1146 and FCoV 1683 were determined using a plaque assay. Fcwf- CU cells were seeded at 5 x 105 cells/ml in a 12-well plate. The following day, when the cells reached 90% confluency, the virus was serially diluted in EMEM. The media was removed, and the wells were washed once with EMEM. Then, 200 µl of the virus 102 inoculum was added to each well, and the plate was incubated at 37°C with 5% CO₂ for 1 hour, shaking every 10 minutes. 0.3% Oxoid agar overlay was prepared by diluting 3% Oxoid agar in pre-warmed EMEM containing 10% heat inactivated FBS, 10% Nu-Serum, and 1% HEPES. 1 ml of overlay was added to each well, and the plate was incubated at 37°C with 5% CO₂ for 72 hours. The cells were then fixed with 4% paraformaldehyde (Thermo) for 30 minutes, stained with 1% crystal violet (Millipore Sigma) for 30 minutes, and washed with water. Plates were left to dry, and plaques were counted to determine the titer: FCoV 79-1683 titer= 6.25x1010 pfu/ml FCoV 79-1146 titer= 1.074x1010 pfu/ml 3.2.13 CAR T cell activation by FCoV-infected Fcwf-4CU cells 5x104 FCWF-Cu cells per well were plated in in 100 µl EMEM supplemented with 10% HI FBS, 10% Nu-Serum, and 1% HEPES and incubated at 37°C with 5% CO2 overnight in a 96 well flat bottom plate. The following day, cells were infected with a multiplicity of infection (MOI) of 0.1 or 1 using a 50 µl inoculum in EMEM without serum and incubated for at least one hour. Medium was aspirated and 2x105 WT or CAR-expressing Jurkat cells in 200 µl complete RPMI were added and co-incubated for 24 hours at 37°C with 5% CO2.Cells were stained and analyzed for CD69 expression by flow cytometry as described above. 3.2.14 pCDNA-EGFP cloning and in vitro transcription pCDNA-EGFP was generated by digesting the enhanced green fluorescent protein (EGFP) and woodchuck hepatitis virus post-transcriptional regulatory element pLenti- 103 CMV-Zeo (Addgene #17449) with BamHI-HF and EcoRI-HF (NEB), gel purifying the fragment and ligating into pCDNA3.1+. For in vitro transcription (IVT), pCDNA- EGFP was linearized using XbaI, extracted with 25:24:1 phenol:chloroform:isoamyl alcohol (Millipore), and concentrated with 5 volumes 100% EtOH + 0.1 volumes NaOAC 3 M pH 5.2 + 7.5 µg Glyoblue. The IVT, DNase, and polyadenylation-tailing reactions were carried using the mMESSAGE mMACHINE T7 Ultra kit (Thermo) according to manufacturer instructions, and mRNA was extracted with phenol:chloroform:isoamyl alcohol, and resuspended in molecular grade water with 0.1 mM EDTA and stored at -80°C. 3.2.15 Primary feline T cell nucleofection Venipunctures were carried out on donor cats by the Cornell Center for Animal Resources and Education following IACUC protocol guidelines. Peripheral blood mononuclear cells were separated from heparinized blood, and T cells were enriched using anti-feline CD3 clone NZM1 (Y. Nishimura, National Institute of Infectious Diseases, Tokyo, Japan) as described.27 Cells were plated in one well of G-Rex 24 well plate (Wilson Wolf) in 1 mL XVIVO-15 (Lonza) + 10% FBS + 2 mM L- glutamine and stimulated with 10 ng/mL recombinant feline interleukin-2 (rfIL-2, R&D Systems) + 25 ng/mL phorbol myristate acetate (Sigma) + 1 µg/mL ionomycin (Sigma). Wells were filled with media + 10 ng/mL rfIL-2 to 8 mL 24 hours later. On day 7, 5x106 T cells per condition were spun down at 200xg for 10 minutes at room temperature. Cells were resuspended in 100 µL Human T Nucleofector Solution for Human T cells (Lonza) and combined with either 2 µg pmax GFP or 5 µg EGFP IVT 104 mRNA and nucleofected in a cuvette using the indicated program on a Nucleofector IIb (Amaxa). 500 µL complete media + 10 ng/mL rfIL-2 was immediately added and cells were transferred to a new G-Rex well to a total volume of 2 mL + 10 ng/mL rfIL- 2. Cells were stained for viability using LIVE/DEAD Near IR and fixed using Cytofix/Cytoperm solution as described above, and viable single cells were analyzed by flow cytometry on an Attune Nxt Cytometer. 3.2.16 Feline gene cloning Predicted feline sequences on NCBI GenBank for CD3z, 4-1BB, and DAP10 were aligned with respective human sequences to identify conserved regions. Primers were designed from these conserved regions for CAR-relevant portions. RNA from primary feline T cells was isolated and cDNA was amplified as described above. CAR-relevant sequences were amplified from feline T cell cDNA by PCR, polyadenylated, ligated into pGEM-T Easy vector (Promega), and transformed into JM109 Competent E. coli (Promega). Plasmid DNA was isolated using a QIAprep Spin Miniprep kit (Qiagen) and sequenced using Sanger sequencing at the Cornell Institute of Biotechnology Genomics Core facility. 3.2.17 Felinized anti-spike CAR construction All felinized CAR constructs contained the fCD8a leader peptide (NM_001009843.2 amino acids 1-23), a Kozak consensus sequence, a FLAG tag, the 18A7.4 ScFv, a spacer sequence, and the fCD8a hinge domain (amino acids 141-185). Silent single nucleotide mutations were made within the Whitlow 218 linker sequence28 of the ScFv 105 to remove BamHI sites. For f18A7.4-28Z, the fCD28 short extracellular sequence, transmembrane, and cytoplasmic domains from fCD28 were used (NM_001009843.2 amino acids 15-221). For f18A7.4—BBZ, the f4-1BB cytoplasmic domain was identified and by aligning sequencing results with GenBank 4-1BB mRNA CDS (XM_045035044.1) to identify 4-1BB CDS then aligning with human 4-1BB (NM_001561.6) to identify the cytoplasmic domain. For fDAP10Z, the fDAP10 transmembrane and cytoplasmic domains were identified by aligning sequencing results with human DAP10 (NP_001007470.1 amino acids 19-55) as described by Li et al.29 All constructs included a P2A sequence followed by truncated human nerve growth factor receptor derived from human 1928Z-LNGFR CAR30 (M. Sadelain, MSKCC). Sequences were synthesized into gene fragments (Azenta Life Sciences), amplified by PCR with Pfu Ultra II polymerase using forward primer 5’ TTTT TTA TAT GTT TAA ACG CCA CCA TGG 3’ and reverse 5’ TTTT TAT AAT GGA TCC TCA GCT GTT CC 3’ to incorporate 5’ PmeI and BamHI sites (underlined), digested with PmeI and BamHI-HF (NEB) ligated into pTiger (Addgene #1728), and transformed into NEB Stable competent E. coli (NEB). Plasmid was purified using EndoFree Plasmid Maxi kit (Qiagen). Transfection into HEK293T cells was performed using FUGENE HD and cells were analyzed for surface FLAG expression as described above on an Attune NxT cytometer. Sequence alignments were performed using Geneious 6.1.4 software. 106 3.2.18 Statistical analysis All statistical analyses were performed using Prism software (GraphPad). Comparisons of three or more data sets were analyzed by Two-way ANOVA with Tukey’s multiple comparisons test. Significance was defined as p<0.05. 3.3 Results 3.3.1 Monoclonal antibody 18A7.4 recognizes an epitope in Types I and II FCoV spike To generate a CAR therapy for FIP, we used a monoclonal antibody (mAb) 18A7.4 that was developed against FIPV 79-1146, a type II virus, and has reactivity against the spike protein.23,24 To confirm reactivity and investigate whether it cross-reacted with type I spike, we performed an immunoblot analysis with spike proteins expressed in HEK293T cells. Transfected Type II FCoV 79-1146 was expressed at low levels but at the expected molecular weight of 220 kDa as detected with 18A7.4, while the Type II FCoV 79-1683 was expressed more abundantly (Figure 3.1A). The same size band was detected in the same samples using antibody to the C-terminal C9 tag (Figure 3.1B). A band for Type I FCoV Black was also detected at the expected molecular weight when blotting for the C9 tag and with 18A7.4 suggesting this antibody may exhibit some cross reactivity, but there was also a second band of lower molecular weight that reacted with both antibodies. The lower molecular weight band was also detected Type I spike 65F samples. Again, both the spike antibody and the C9 tag antibody detected this lower molecular weight band. While additional studies are necessary to confirm it, this lower band may represent a cleaved form of the 107 protein. Type I spikes 28O and 27C were minimally detected and were also at the lower-than-expected molecular weight. While the FLAG tag on spike from severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) was detected with FLAG antibody, 18A7.4 did not cross react, demonstrating that this antibody had specificity for feline Alphacoronavirus and not an unrelated Betacoronavirus. Empty vector transfected lysates had no reactivity to FLAG, C9, or 18A7.4. All lysates contained similar amounts of protein as detected by a-tubulin immunoblot. These results indicate that the monoclonal anti-spike antibody 18A7.4 reacts with linearized Type II and possibly Type I FCoV spike proteins. 108 Figure 3.1. Anti-spike mAb 18A7.4 detects type I and type II coronavirus spike proteins by western blot. HEK293T cells were transfected with empty pCDNA3.1+ or plasmids encoding coronavirus spike proteins from Type I, or Type II FCoV or the Betacoronavirus SARS-CoV-2. Two days following transfection, cells were lysed, and protein lysates were assayed by immunoblotting for spike on two different gels using (A) 18A7.4 anti-spike, or (B) for the C9 tag for FCoV spike or FLAG tag for SARS-CoV-2 spike. Immunoblots were stripped and re-probed for α-tubulin as a loading control. An HRP-conjugated goat-anti mouse secondary antibody was used for each blot. Representative data from n=5 experiments. FCoV= feline coronavirus; HRP= horseradish peroxidase; mAb= monoclonal antibody; SARS-CoV-2 severe acute respiratory syndrome coronavirus 2. 109 3.3.2 mAb 187A.4 specifically binds native Type II but not Type I FCoV spike We next tested whether mAb 18A7.4 could detect Types I and Type II FCoV spike expressed on the surface of cells, which would be necessary for development of a successful spike directed CAR. HEK293 cells transfected with 79-1683 and 79-1146, but not control empty pCDNA vector, were labeled with 18A7.4 with a higher percentage of cells expressing 79-1146 (63.1%) compared to 79-1683 (31%) (Figure 3.2A). No cells transfected Type I spike genes were positive. Lack of 18A7.4 binding to Type I spike protein was not due to failure of Type I spike to traffic to the cell surface, since intracellularly staining with 18A7.4 was also negative. Intracellular staining for 79-1683 and 79-1146 spikes resulted in higher percent positive cells (89.2% vs 31% for 79-1683 and 91.2% vs 63.1% for 79-1146) indicating not all synthesized spike was localized to the surface (Figure 3.2B). HEK293T cells transfected with all spike genes stained intracellularly for the C9 tag, thus they were all expressed following transfection (Figure 3.2C). We conclude that mAb 18A7.4 recognizes the native conformations of Type II, but not Type I, FCoV spike proteins. 110 Figure 3.2. Surface and intracellular recognition of native Types I and II FCoV spike by 18A7.4. HEK293T cells were transfected with empty pCDNA3.1+ or plasmids encoding spike proteins from Type I or Type II FCoV. Two days following transfection, cells were harvested and stained for (A) surface spike expression by 18A7.4, or permeabilized and stained for intracellular spike expression by (B) 18A7.4 or (C) anti-C9. An AlexaFluor647-conjugated goat-anti mouse secondary antibody was used for all samples. Cells were analyzed by flow cytometry gating off viable, single cells. Representative data from n=4 independent experiments. 3.3.3 Anti-spike CAR T cells demonstrate functionality using 18A7.4 ScFv To create the anti-spike CAR, we first cloned the variable heavy and light chain sequences from 187A.4. These sequences were then put in tandem with a linker to generate an ScFv. The 18A7.4 ScFv with an N-terminal 3X FLAG tag was cloned into the second generation pSLCAR lentiviral vector. Two different 18A7.4 CARs were made with different costimulatory domains, CD28 and 4-1BB. This construct also included a CD8a hinge, CD28 transmembrane, and CD3z cytoplasmic domains. The CAR was followed by a P2A and enhanced green fluorescent protein (EGFP). The final CARs were called 18A7.4-28Z CAR and 18A7.4-BBZ CAR (Figure 3.3A). 111 112 Figure 3.3. Design and functionality of an anti-spike CAR. A 3X FLAG-tagged ScFv gene fragment encoding the variable light and heavy chain sequences of 18A7.4 connected by the 218 linker sequence was cloned into the pSLCAR backbone lentiviral vectors to replace the native anti-CD19 ScFv. (A) Schematic of the second-generation anti-spike CAR constructs with the 18A7.4 ScFv and either CD28 or 4-1BB costimulatory domains. Created in BioRender. Jurkat T cells were transduced with either 18A7.4 CAR construct packaged into lentivirus, followed by FLAG MACS enrichment for CAR surface expression and (B) post-enrichment purity was determined by flow cytometry for FLAG and EGFP expression compared to WT. CAR specificity and functionality was determined by co-incubating (C) WT, CD19, or 18A7.4 CAR Jurkat cells with Raji or HEK293T transfected empty vector or Types I and II FCoV spike plasmids or by (D) co-incubating WT or 18A7.4 CAR Jurkat cells with Fcwf-4CU cells infected with live Type II FcoV strains 79-1683 or 79-1146 at MOI 1 and 0.1 for 24 hours in triplicate at a 2:1 effector to target ratio for 24 hours and analyzing single Jurkat cells for surface CD69 expression by flow cytometry. Mean ± SEM from n=3 independent experiments. Two-way ANOVA with Tukey’s test for multiple comparisons. * p<0.05, ** p<0.01, **** p<0.0001. AF647=AlexaFluor647; CAR= chimeric antigen receptor; EGFP= enhanced green fluorescent protein; MFI= mean fluorescence intensity; ScFv= single-chain variable fragment; TM=transmembrane domain. We transduced the human Jurkat T cell line with 18A7.4-28Z or 18A7.4-BBZ and enriched for CAR+ cells using magnetic bead sorting for surface FLAG tag. Post- enrichment 18A7.4-28Z transduced cells were 67.4% positive for surface expression of the CAR and EGFP and 97.6% 18A7.4-BBZ CAR T cells were CAR+EGFP+ (Figure 3.3B). There was strong correlation between surface expression and GFP positivity. To determine both specificity and functionality of the new anti-FIP spike CARs, we co-incubated the enriched CAR-expressing Jurkat T cells with target cells. Jurkat T cells expressing 18A7.4-28Z or 18A7.4-BBZ CARs had higher basal CD69 expression compared to wild type (WT) Jurkat T cells without a CAR. This was true without coincubation with targets, or when co-incubated with Raji or empty pCDNA- transfected HEK293T cells. However, 18A7.4-28Z or 18A7.4-BBZ CAR-expressing Jurkat T cells increased CD69 expression when incubated with HEK293T target cells expressing Type II spike proteins from 79-1683 or 79-1146 (Figure 3.3C). Consistent 113 with the binding of the parental 18A7.4 mAb to native spike, there was no increase in CD69 expression observed against any Type I spike proteins for either construct. Jurkat cells without a CAR failed to upregulate CD69 when co-incubated with HEK293T cells transfected with empty vector, Types I, or II FcoV spike proteins. Control CD19-BBZ CAR Jurkat T cells highly upregulated CD69 when co-incubated with Raji B cells, which express the CD19 target, but not to any of the other target cells (Figure 3.3C). We next determined whether 18A7.4-28Z or 18A7.4-BBZ CAR T cells could detect feline coronavirus infected cells. We infected Fcwf-4CU cells with live 79-1683 or 79- 1146 at multiplicity of infection (MOI) 1 and MOI 0.1. Infection and spike expression were confirmed on these infected cells by immunofluorescence for spike. Jurkat T cells expressing either of the two 18A7.4 spike directed CARs increased CD69 expression when incubated with infected targets compared to the cells incubated with uninfected cells (Figure 3.3D). The response was higher with higher MOI. Interestingly, CD69 expression was slightly higher on cells incubated with 79-1683 infected cells compared to 79-1146 infected cells. This is different from the results we observed with HEK293 transfected cells expressing the same spike proteins. Regardless, we conclude that our 18A7.4-CARs are functional and can respond to native spike on infected cells. 3.3.4 mRNA nucleofection successfully expresses exogenous genes in feline T cells 114 We have previously demonstrated that primary feline T cells can be transduced with FIV-based lentivirus to express a CAR following stimulation with rfIL-2 and PMA/I.18 While viral transduction along with gene editing tools such as clustered regularly interspaced palindromic repeats (CRISPR)/Cas9 or transcription activator-like effector nucleases (TALEN) to generate CAR T cells with targeted knockouts is useful and a good first approach,31–36 it may be beneficial to investigate alternative methods of expressing exogenous genes in feline T cells that are virus-independent. We next tested a nonviral delivery method, nucleofection. This is a newer method to deliver in vitro transcribed (IVT) mRNA into primary cells for temporary expression.37 We tested different nucleofection programs using IVT mRNA to transiently express EGFP in primary feline T cells. Over a 72-our time course, programs U024 and V024 resulted in stable expression of EGFP (Figure 3.4A). Across five donors, U024 and V024 yielded means of 20.5% and 21.4% EGFP expression at 72 hours, respectively, while the manufacturer recommended protocol, T023, only yielded a mean of 11.7% at 72 hours (Figure 3.4B). As a control, we included the pmaxGFP plasmid using program T023, which consistently only yielded <10% EGFP expression across all donors throughout the time course, indicating low efficiency of expressing plasmid nucleofection (Figure 3.4B). Interestingly, in two separate experiments using T cells from the same donor program U024 yielded <6% expression, indicating that this donor may be refractory to that program. 115 Figure 3.4. Nucleofection of primary feline T cells. Feline T cells were CD3-enriched from peripheral blood, stimulated with rfIL-2 and PMA/I, and nucleofected with either pmaxGFP plasmid or IVT mRNA encoding EGFP. Viable single cells were then analyzed by flow cytometry for EGFP expression (A) Representative data from one donor of EGFP expression using different nucleofector conditions across a 72-hour time course. (B) Summary data of EGFP expression by nucleofector conditions from n=5 donors across five independent experiments. Two-way ANOVA with Tukey’s multiple comparison’s test. * p<0.05; ns= not significant. EGFP= enhanced green fluorescent protein; IVT= in vitro transcribed; PMA/I= phorbol myristate acetate with ionomycin. 116 3.3.5 Felinized anti-spike CAR stably expressed in mammalian cells To further demonstrate the feasibility of CAR T cell therapy in cats for the treatment of FIP, we designed felinized versions of the 18A7.4 CARs. We obtained the feline versions of the CAR domains that had not been previously validated by aligning the predicted feline sequence with the known human sequence to generate primers for PCR, and then cloned the resulting fragment into a plasmid for sequencing. Using the 18A7.4 ScFv with a FLAG tag, we then incorporated feline CD8a hinge, CD28 transmembrane domain, CD28 or 4-1BB cytoplasmic domains, and CD3z signaling domain. We also designed a third construct incorporating feline DAP10 transmembrane and cytoplasmic domains along with CD3z (Figure 3.5A). To determine if these constructs could be stably expressed, we transfected them into HEK293T cells and tested surface CAR expression through staining for FLAG by flow cytometry. We also transfected empty pCDNA3.1+ and the human CD19-BBZ as negative control and positive controls, respectively. While there was <7% background expression detected with pCDNA3.1+, all three felinized CAR vectors expressed at 70% or higher, which exceeded the level of expression detected of human CD19-BBZ CAR (Figure 3.5B). These data demonstrate that the felinized anti-spike CARs are stably expressed on the surface of mammalian cells. 117 Figure 3.5 Expression of felinized anti-spike CARs in mammalian cells. (A) Schematic representation of felinized anti-spike CAR constructs. Created in BioRender. HEK293T cells were transfected with empty pCDNA3.1+, human CD19-BBZ CAR, or three different felinized anti-spike CAR constructs. Cells were harvested on day 2 following transfection and (B) analyzed by flow cytometry for surface FLAG expression. Gated single cells from n=1 experiments. CAR= chimeric antigen receptor. 3.4 Discussion Despite advances in the use of antivirals that have resulted in remarkable clinical improvements for FIP patients, it remains a challenging disease to treat in those patients who are refractory, or who relapse. Here we show preclinical development of a CAR T cell therapy targeting the surface spike protein of FIPV-infected cells. Using 118 anti-spike mAb 18A7.4 to generate an ScFv,23,24 we created two separate anti-spike CAR constructs containing a CD3z cytoplasmic domain and either a CD28 or 4-1BB costimulatory domain. Both constructs demonstrated specificity and were functional in the presence of transfected Type II FCoV spike, and FCoV-infected target cells. We also created felinized versions of these constructs, as well as an additional construct incorporating the DAP10 transmembrane and cytoplasmic domains, which may allow for an additional targeting mechanism through association with natural killer group 2D.29,38,39 All of these novel CARs were stably expressed on the surface of mammalian cells. Additionally, we demonstrated nucleofection as a feasible alternative method to viral transduction to express exogenous genes in primary feline T cells. Although cats can have chronic FCoV infection, the onset of FIP marks a fairly rapid deterioration in health depending on whether cats have some cell-mediated immunity (and thus present in the dry form) or have minimal cell-mediated immunity (and thus present in the wet form).40,41 The two anti-spike CARs, containing either CD28 or 4- 1BB costimulatory domains, were similarly functional when expressed in T cells, thus the choice of which costimulatory domain to use would be dictated by therapeutic need. CAR T cells with CD28 co-stimulatory domain have high glycolytic metabolism and a more effector phenotype but may not persist long due to exhaustion.42,43 In contrast, 4-1BB-containg CARs have a metabolic phenotype characterized by oxidative phosphorylation, which is associated with a more memory phenotype and longer persistence.42,43 Because of how fast the disease can progress, a CD28 119 costimulatory domain may be preferred in the case of an acutely fatal disease as a means to rapidly eliminate the infection. Incorporation of both domains may prove more efficacious, as similar constructs have outperformed constructs incorporating only one of the costimulatory domains.44 Our studies with mAb 18A7.4 lay the groundwork for development of Type I spike-specific CARs against the more clinically relevant viral protein.45 Interestingly, the recent outbreak of FCoV-23 in Cyprus was of the Type II serotype, making our CAR against Type II spike more clinically relevant.46 One major limitation to CAR T cell therapy is the need to use autologous cells due to the risk of a graft vs. host disease response that allogeneic T cells would induce through TCR and MHC. Some groups have successfully employed CRISPR or TALEN to knockout endogenous TCR and b2-microglobulin, thereby preventing allogenic CAR T cells from attacking healthy host tissue while also protecting them from rejection.31–36 Loss of MHC expression does make the CAR T cells susceptible to targeting by host natural killer cells, but insertion of human leukocyte antigen E in place of b2-microglobulin should protect them by inhibiting natural killer cells.32 Because most cats with FIP are lymphopenic it is challenging to obtain sufficient cells to develop a CAR therapeutic from a sick animal,2 therefore it would be desirable to develop methods for rapid and high level allogeneic T cell expansion. Moreover, development and cryopreservation of allogeneic CAR T cells could permit multiple doses or be used to treat multiple patients from one batch production. Another 120 challenge for generating autologous CAR T cells for FIP is timing because patients with severe/refractory disease would not survive long enough to manufacture the CAR T cells from their blood. Thus, to become clinically feasible, an “off the shelf” product is likely needed. Long-term maintenance of CAR T cells may not be necessary in the case of an acute viral infection, thus introducing genes by IVT mRNA would allow for generation of short-term CAR T cells in vivo that are lost within a few days following elimination of the virus. Our studies demonstrate successful expression of IVT mRNA encoding EGFP expressed in in primary feline T cells by nucleofections. GFP expression was maintained for 72 hours, which would likely be sufficient for a therapy. Our studies also optimized the nucleofection protocol with a human nucleofector kit, but additional adaptations to the protocol may enhance the efficiency for feline cells. IVT mRNA has been previously used to transiently express a CAR,17,47 which we propose may be preferred in the context of FIP to ensure that CAR T cells are temporarily active to clear the infection while limiting development of dangerous treatment sequelae such as cytokine release syndrome.48–50 Overall, we present here a proof of concept for the use of CAR T cell therapy to treat FIP, as well as mRNA nucleofection as an alternative method of expressing exogenous genes in primary feline T cells. 121 REFERENCES 1. Licitra BN, Millet JK, Regan AD, et al. Mutation in spike protein cleavage site and pathogenesis of feline coronavirus. Emerg Infect Dis. 2013;19(7):1066-1073. doi:10.3201/eid1907.121094 2. Addie D, Belák S, Boucraut-Baralon C, et al. Feline Infectious Peritonitis: ABCD Guidelines on Prevention and Management. Journal of Feline Medicine and Surgery. 2009;11(7):594-604. doi:10.1016/j.jfms.2009.05.008 3. Jaimes JA, Whittaker GR. Feline coronavirus: Insights into viral pathogenesis based on the spike protein structure and function. Virology. 2018;517:108-121. doi:10.1016/j.virol.2017.12.027 4. Pedersen NC, Perron M, Bannasch M, et al. Efficacy and safety of the nucleoside analog GS-441524 for treatment of cats with naturally occurring feline infectious peritonitis. J Feline Med Surg. 2019;21(4):271-281. doi:10.1177/1098612X19825701 5. Murphy BG, Perron M, Murakami E, et al. The nucleoside analog GS-441524 strongly inhibits feline infectious peritonitis (FIP) virus in tissue culture and experimental cat infection studies. Vet Microbiol. 2018;219:226-233. doi:10.1016/j.vetmic.2018.04.026 122 6. Green J, Syme H, Tayler S. Thirty‐two cats with effusive or non‐effusive feline infectious peritonitis treated with a combination of remdesivir and GS‐441524. Veterinary Internal Medicne. 2023;37(5):1784-1793. doi:10.1111/jvim.16804 7. Coggins SJ, Norris JM, Malik R, et al. Outcomes of treatment of cats with feline infectious peritonitis using parenterally administered remdesivir, with or without transition to orally administered GS ‐441524. Veterinary Internal Medicne. 2023;37(5):1772-1783. doi:10.1111/jvim.16803 8. US Food and Drug Administration. FDA Announces Position on Use of Compounded GS-441524 to Treat FIP. May 10, 2024. Accessed November 16, 2024. https://www.fda.gov/animal-veterinary/cvm-updates/fda-announces- position-use-compounded-gs-441524-treat-fip 9. Jackson HJ, Rafiq S, Brentjens RJ. Driving CAR T-cells forward. Nat Rev Clin Oncol. 2016;13(6):370-383. doi:10.1038/nrclinonc.2016.36 10. Levine BL. Performance-enhancing drugs: design and production of redirected chimeric antigen receptor (CAR) T cells. Cancer Gene Ther. 2015;22(2):79-84. doi:10.1038/cgt.2015.5 11. Sadelain M, Brentjens R, Rivière I. The basic principles of chimeric antigen receptor design. Cancer Discov. 2013;3(4):388-398. doi:10.1158/2159-8290.CD- 12-0548 123 12. Guedan S, Calderon H, Posey AD, Maus MV. Engineering and Design of Chimeric Antigen Receptors. Molecular Therapy - Methods & Clinical Development. 2019;12:145-156. doi:10.1016/j.omtm.2018.12.009 13. United States Food and Drug Administration. Approved Cellular and Gene Therapy Products. April 26, 2024. https://www.fda.gov/vaccines-blood- biologics/cellular-gene-therapy-products/approved-cellular-and-gene-therapy- products 14. Panjwani MK, Atherton MJ, MaloneyHuss MA, et al. Establishing a model system for evaluating CAR T cell therapy using dogs with spontaneous diffuse large B cell lymphoma. Oncoimmunology. 2020;9(1):1676615. doi:10.1080/2162402X.2019.1676615 15. Sakai O, Yamamoto H, Igase M, Mizuno T. Optimization of Culture Conditions for the Generation of Canine CD20-CAR-T Cells for Adoptive Immunotherapy. In Vivo. 2022;36(2):764-772. doi:10.21873/invivo.12763 16. Sakai O, Igase M, Mizuno T. Optimization of canine CD20 chimeric antigen receptor T cell manufacturing and in vitro cytotoxic activity against B‐cell lymphoma. Vet Comp Oncol. 2020;18(4):739-752. doi:10.1111/vco.12602 17. Panjwani MK, Smith JB, Schutsky K, et al. Feasibility and Safety of RNA- transfected CD20-specific Chimeric Antigen Receptor T Cells in Dogs with Spontaneous B Cell Lymphoma. Mol Ther. 2016;24(9):1602-1614. doi:10.1038/mt.2016.146 124 18. Cockey JR, Zhou GM, Kulp EN, Urbina CA, Kerkenpass C, Leifer CA. Generation of primary feline chimeric antigen receptor T cells. Published online American Journal of Veterinary Research. In Press. 19. Guo X, Kazanova A, Thurmond S, Saragovi HU, Rudd CE. Effective chimeric antigen receptor T cells against SARS-CoV-2. iScience. 2021;24(11):103295. doi:10.1016/j.isci.2021.103295 20. Maldini CR, Claiborne DT, Okawa K, et al. Dual CD4-based CAR T cells with distinct costimulatory domains mitigate HIV pathogenesis in vivo. Nat Med. 2020;26(11):1776-1787. doi:10.1038/s41591-020-1039-5 21. Anthony-Gonda K, Bardhi A, Ray A, et al. Multispecific anti-HIV duoCAR-T cells display broad in vitro antiviral activity and potent in vivo elimination of HIV-infected cells in a humanized mouse model. Sci Transl Med. 2019;11(504):eaav5685. doi:10.1126/scitranslmed.aav5685 22. Sautto GA, Wisskirchen K, Clementi N, et al. Chimeric antigen receptor (CAR)- engineered T cells redirected against hepatitis C virus (HCV) E2 glycoprotein. Gut. 2016;65(3):512-523. doi:10.1136/gutjnl-2014-308316 23. Olsen CW, Corapi WV, Jacobson RH, Simkins RA, Saif LJ, Scott FW. Identification of antigenic sites mediating antibody-dependent enhancement of feline infectious peritonitis virus infectivity. J Gen Virol. 1993;74 ( Pt 4):745- 749. doi:10.1099/0022-1317-74-4-745 125 24. Corapi WV, Olsen CW, Scott FW. Monoclonal antibody analysis of neutralization and antibody-dependent enhancement of feline infectious peritonitis virus. J Virol. 1992;66(11):6695-6705. doi:10.1128/JVI.66.11.6695- 6705.1992 25. Krebber A, Bornhauser S, Burmester J, et al. Reliable cloning of functional antibody variable domains from hybridomas and spleen cell repertoires employing a reengineered phage display system. J Immunol Methods. 1997;201(1):35-55. doi:10.1016/s0022-1759(96)00208-6 26. Bloemberg D, Nguyen T, MacLean S, et al. A High-Throughput Method for Characterizing Novel Chimeric Antigen Receptors in Jurkat Cells. Mol Ther Methods Clin Dev. 2020;16:238-254. doi:10.1016/j.omtm.2020.01.012 27. Nishimura Y, Shimojima M, Sato E, et al. Downmodulation of CD3epsilon expression in CD8alpha+beta- T cells of feline immunodeficiency virus-infected cats. J Gen Virol. 2004;85(Pt 9):2585-2589. doi:10.1099/vir.0.80102-0 28. Whitlow M, Bell BA, Feng SL, et al. An improved linker for single-chain Fv with reduced aggregation and enhanced proteolytic stability. Protein Eng Des Sel. 1993;6(8):989-995. doi:10.1093/protein/6.8.989 29. Li S, Zhao R, Zheng D, et al. DAP10 integration in CAR-T cells enhances the killing of heterogeneous tumors by harnessing endogenous NKG2D. Molecular Therapy - Oncolytics. 2022;26:15-26. doi:10.1016/j.omto.2022.06.003 126 30. Zhao Z, Condomines M, van der Stegen SJC, et al. Structural Design of Engineered Costimulation Determines Tumor Rejection Kinetics and Persistence of CAR T Cells. Cancer Cell. 2015;28(4):415-428. doi:10.1016/j.ccell.2015.09.004 31. Sugita M, Galetto R, Zong H, et al. Allogeneic TCRαβ deficient CAR T-cells targeting CD123 in acute myeloid leukemia. Nat Commun. 2022;13(1):2227. doi:10.1038/s41467-022-29668-9 32. Jo S, Das S, Williams A, et al. Endowing universal CAR T-cell with immune- evasive properties using TALEN-gene editing. Nat Commun. 2022;13(1):3453. doi:10.1038/s41467-022-30896-2 33. Georgiadis C, Preece R, Nickolay L, et al. Long Terminal Repeat CRISPR-CAR- Coupled “Universal” T Cells Mediate Potent Anti-leukemic Effects. Molecular Therapy. 2018;26(5):1215-1227. doi:10.1016/j.ymthe.2018.02.025 34. Qasim W, Zhan H, Samarasinghe S, et al. Molecular remission of infant B-ALL after infusion of universal TALEN gene-edited CAR T cells. Sci Transl Med. 2017;9(374):eaaj2013. doi:10.1126/scitranslmed.aaj2013 35. Eyquem J, Mansilla-Soto J, Giavridis T, et al. Targeting a CAR to the TRAC locus with CRISPR/Cas9 enhances tumour rejection. Nature. 2017;543(7643):113-117. doi:10.1038/nature21405 127 36. Poirot L, Philip B, Schiffer-Mannioui C, et al. Multiplex Genome-Edited T-cell Manufacturing Platform for “Off-the-Shelf” Adoptive T-cell Immunotherapies. Cancer Res. 2015;75(18):3853-3864. doi:10.1158/0008-5472.CAN-14-3321 37. Thuille N, Sajinovic T, Siegmund K, Baier G. Chemically modified mRNA nucleofection of primary human T cells. Journal of Immunological Methods. 2020;487:112878. doi:10.1016/j.jim.2020.112878 38. Gilfillan S, Ho EL, Cella M, Yokoyama WM, Colonna M. NKG2D recruits two distinct adapters to trigger NK cell activation and costimulation. Nat Immunol. 2002;3(12):1150-1155. doi:10.1038/ni857 39. Wu J, Song Y, Bakker ABH, et al. An Activating Immunoreceptor Complex Formed by NKG2D and DAP10. Science. 1999;285(5428):730-732. doi:10.1126/science.285.5428.730 40. Satoh R, Kaku A, Satomura M, et al. Development of monoclonal antibodies (MAbs) to feline interferon (fIFN)-γ as tools to evaluate cellular immune responses to feline infectious peritonitis virus (FIPV). J Feline Med Surg. 2011;13(6):427-435. doi:10.1016/j.jfms.2011.01.008 41. Pedersen NC. A review of feline infectious peritonitis virus infection: 1963-2008. J Feline Med Surg. 2009;11(4):225-258. doi:10.1016/j.jfms.2008.09.008 42. Kawalekar OU, O’Connor RS, Fraietta JA, et al. Distinct Signaling of Coreceptors Regulates Specific Metabolism Pathways and Impacts Memory 128 Development in CAR T Cells. Immunity. 2016;44(2):380-390. doi:10.1016/j.immuni.2016.01.021 43. Long AH, Haso WM, Shern JF, et al. 4-1BB costimulation ameliorates T cell exhaustion induced by tonic signaling of chimeric antigen receptors. Nat Med. 2015;21(6):581-590. doi:10.1038/nm.3838 44. Zhong XS, Matsushita M, Plotkin J, Riviere I, Sadelain M. Chimeric Antigen Receptors Combining 4-1BB and CD28 Signaling Domains Augment PI3kinase/AKT/Bcl-XL Activation and CD8+ T Cell–mediated Tumor Eradication. Molecular Therapy. 2010;18(2):413-420. doi:10.1038/mt.2009.210 45. Jaimes JA, Millet JK, Stout AE, André NM, Whittaker GR. A Tale of Two Viruses: The Distinct Spike Glycoproteins of Feline Coronaviruses. Viruses. 2020;12(1):E83. doi:10.3390/v12010083 46. Warr A, Attipa C, Gunn‐Moore D, Tait‐Burkard C. FCoV‐23 causing FIP in a cat imported to the UK from Cyprus. Veterinary Record. 2023;193(10):414-415. doi:10.1002/vetr.3696 47. Beatty GL, Haas AR, Maus MV, et al. Mesothelin-Specific Chimeric Antigen Receptor mRNA-Engineered T Cells Induce Antitumor Activity in Solid Malignancies. Cancer Immunology Research. 2014;2(2):112-120. doi:10.1158/2326-6066.CIR-13-0170 129 48. Atherton MJ, Rotolo A, Haran KP, Mason NJ. Case Report: Clinical and Serological Hallmarks of Cytokine Release Syndrome in a Canine B Cell Lymphoma Patient Treated With Autologous CAR-T Cells. Front Vet Sci. 2022;9:824982. doi:10.3389/fvets.2022.824982 49. Acharya UH, Dhawale T, Yun S, et al. Management of cytokine release syndrome and neurotoxicity in chimeric antigen receptor (CAR) T cell therapy. Expert Rev Hematol. 2019;12(3):195-205. doi:10.1080/17474086.2019.1585238 50. Davila ML, Riviere I, Wang X, et al. Efficacy and toxicity management of 19- 28z CAR T cell therapy in B cell acute lymphoblastic leukemia. Sci Transl Med. 2014;6(224):224ra25. doi:10.1126/scitranslmed.3008226 130 CHAPTER 4 Conclusions, limitations, and future directions 131 4.1 Summary of Findings This thesis describes efficient methods to not only enrich, activate, and expand primary feline T cells, but for the first time also demonstrates that they can be engineered to functionally express a CAR. Additionally, this thesis also demonstrates a proof of concept for CAR T cell therapy as an alternative antiviral strategy for the treatment of FIP. In Chapter 2, I investigated optimal methods of expanding and engineering primary feline T cells to be used for CAR T cell therapy, which has previously only been investigated in humans and canines but not felines. Using a feline-specific CD3 mAb,1 I demonstrated that by MACS feline T cells could be consistently enriched to >97% purity following Ficoll separation of peripheral blood. Conventionally, CD3/CD28 activating beads are used to activate primary T cells and stimulate proliferation. Although a feline-specific CD3 mAb exists, there is currently no commercially available feline-specific CD28 mAb. One of the drawbacks in performing feline- focused research is the paucity of feline-specific reagents. Thus, I tested combinations of cytokines and mitogenic stimuli, which are more classical ways to activate T cells. I found that rfIL-2 alone or in combination with rhIL-21 maintained viability but did not induce activation or substantial proliferation, while rfIL-2 with either ConA or PMA/I induced multiple rounds of division and significant activation. 132 To investigate whether I could polarize feline T cells into TH1-like or Treg-like subsets, I cultured them with ConA or PMA/I in combination with rfIL-2 and rfIL-12 or rfIL-2 and TGFb1 for TH1-like and Treg-like conditions, respectively. I found that neither ConA nor PMA/I induced upregulation of TH1 marker Tbet, but both conditions upregulated Ifng expression and induced secretion of IFN-g, though the relative level of secretion was higher with PMA/I. PMA/I induced a greater fold change in Il10 and Treg marker Foxp3 expression relative to ConA and induced increased IL-10 secretion relative to TH0 and TH1 conditions per donor. Thus, it seems PMA/I was able to more efficiently polarize TH1-like and Treg-like subsets. To determine the optimal ex vivo expansion stimuli, I cultured feline T cells in rfIL-2 with ConA or PMA/I for twelve days in a G-Rex plate, counting cell numbers every four days. Across four donors, PMA/I yielded significantly higher expansion at days 8 and 12, indicating it would likely serve as a better stimulus to expand feline T cells to clinically relevant numbers. Lastly, I determined whether primary feline CAR T cells could be generated and whether they would be functional. Following PMA/I stimulation and a four-day G- Rex, expansion I transduced the cells with FIV-based lentivirus to express a second generation human CD19 CAR. These cells demonstrated significant cytotoxicity against human CD19+ target cells relative to mock-transduced cells and significantly less cytotoxicity towards CD19KO target cells, thus demonstrating for the first time that primary feline CAR T cells could be generated through lentiviral transduction and demonstrate specific effector function. 133 In Chapter 3, outlined the design of a CAR construct targeting the spike protein of FCoV. Through flow cytometry and western blotting, I determined that mAb 18A7.4 previously developed at Cornell by Dr. Fred Scott2,3 was specific for both Type II FECV and FIPV spike proteins, but not Type I FCoV or SARS-CoV-2 spikes. I then cloned the variable heavy and light chain genes from this hybridoma to generate the ScFv portion of two second generation anti-spike CAR constructs with either CD28 or 4-1BB costimulatory domains followed by CD3z. I transduced human Jurkat T cells with these CAR constructs and found that they were both stably expressed on the cell surface. Against Type II spike-transfected cells, both constructs conferred an activation signal that was not observed against empty vector or Type I spike- transfected cells. I next performed the assay against Type II FECV and FIPV-infected target cells and found again that both constructs conferred an activation signal that was dependent on the MOI. This is further evidence for surface expression of spike protein on cells infected in vitro. The level of activation conferred between both constructs in each condition was not significantly different, thus demonstrating preclinically that anti-spike CAR T cells are a feasible alternative antiviral to eliminate FCoV infection in cats with FIP. This could be further tested through an in vitro cytotoxicity assay of the CAR T cells against infected cells, although this would require some optimization as the cell culture-adapted FIPV strains are highly cytopathic and thus the timing of the assay would be critical in resolving actual target cell killing from spontaneous lysis due to infection. Additionally, I successfully nucleofected primary feline T cells with IVT mRNA, demonstrating a non-viral method for expression of exogenous genes. 134 This demonstrates that feline T cells may be amenable to electroporation, which has been utilized in clinical-grade protocols to genetically engineer human T cells. 4.2 Limitations of Chapter 2 Although primary feline T cells could be activated, polarized, and engineered to express a CAR, there are some limitations regarding the application of these findings. Mitogenic stimuli like ConA or PMA/I are sufficient for in vitro experiments, but not for GMP-grade clinical expansion of cells for therapeutic purposes. While I was able to demonstrate polarization of feline T cells using both ConA and PMA/I, I cannot definitively conclude that these cells were TH1 or Treg subsets. There are no feline- specific antibodies for Tbet or Foxp3 that could be used for intracellular flow cytometry stain of these cells to verify that they are indeed expressing these respective lineage transcription markers beyond just an mRNA level, although one anti-human Foxp3 mAb has been shown to have cross-reactivity to feline and thus could be potentially utilized.4 I also did not analyze these cells at a single-cell RNA level that would have provided a better separation of populations based on gene expression. Moreover, there were also CD8+ T cells within these cultures as they were enriched total T cells, and the effects that the stimulation conditions may have had on them or their own effects on their CD4+ counterparts was not investigated. It is possible that rfIL-12 addition may have also stimulated the CD8+ population to express and secrete IFN-g as it is pro-inflammatory, thus further contributing to the observed results. 135 rhTGF-b1, on the other hand, would most likely dampen any inflammatory response in these cells. In terms of clinical expansion, the G-Rex system is widely utilized in both academic and industrial cell therapy systems to efficiently expand cells ex vivo with minimal handling. While I was able to expand feline T cells up to 30-fold in twelve days of culture in a G-Rex plate, I did not test the maximum number of cells I could obtain. Because I was conducting multiple experiments at once using enriched cells from the same donors, I only seeded 1x106 T cells/well in the G-Rex plate for the expansion assay. However, for clinical purposes I would seed the total cell population, which should dramatically enhance the total yield, especially if the cells are allowed to grow past the day 12 timepoint where I terminated the assay. For human cell therapy patients, the dose of cells infused generally ranges between 106-108 total CAR+ cells when dosage is based off of cells/kg,5–8 although one clinical trial infused up to 5x109 irradiated CAR NK92 cells.9 If the average mass of a domestic cat is approximately 5 kg, then this would equate to 5x107 total CAR+ cells if dosage is set at 1x107 cells/kg, though the required dosage to treat a systemic infection like FIP may need to be higher. Thus, the numbers that I was able to achieve may be have clinical relevance, but this would most likely need to be tested through dose escalation in a clinical trial. Although I was able to transduce feline T cells with an FIV-based lentivirus to express a CAR, there are future experiments that could be conducted to potentially optimize this process. I was limited by my lentivirus titer and thus chose to transduce 1x106 per 136 donor at an MOI of approximately one, but for future experiments I could generate larger batches of lentivirus to test a range of different MOIs to determine which would give optimal transduction efficiency. My staining for LNGFR demonstrated transduction efficiency, but staining using an anti-mouse secondary for CAR surface detection was not very sensitive. This could be optimized by staining instead for biotinylated antigen that should bind to the CAR (in this case CD19). My readouts also all took place three days following transduction, so future optimization experiments could keep the cells in culture longer to determine how stable CAR expression under the CMV promoter is over time, as this promoter is known to undergo silencing in T cells.10,11 Although the feline CAR T cells did prove functional by cytotoxicity, other readouts such as IFN-g secretion could have further demonstrated effector function, but in my initial attempts at performing this assay I found that the mock-transduced cells had similar amounts of IFN-g secretion against specific and non-specific target cells as the CAR T cells, likely due to the increased basal activation state following PMA/I stimulation. It is possible that allowing the CAR T cells to “rest down” for at least an additional day or multiple days could potentially lower the basal activation state prior to performing this experiment again, which should allow for more clear resolution of target-specific IFN-g secretion. 4.3 Limitations of Chapter 3 One of the main limitations to my effector assays involving anti-spike CAR T cells was that I only used a human T cell line to conduct these experiments. Because the 137 Jurkat T cells are amenable to lentiviral transduction, this allowed me to generate stable lines to use for experiments. The next step then is to test the effector function of the anti-spike CAR constructs in primary feline T cells, ideally using the felinized versions. Because Jurkat is a human CD4+ T cell line and therefore not cytotoxic, my readout for CAR functionality was activation of the cells through surface CD69 upregulation, which is a robust method to rapidly test CAR function.12 However, testing cytotoxicity using primary feline CAR T cells against spike-transfected or FCoV-infected target cells may better predict clinical functionality. Stably transfected or transduced targets expressing spike would likely be better compared to FCoV- infected targets, as the cell culture-adapted FCoV strains are highly cytopathic and thus cause high background target cell death. While both CAR constructs did induce activation against Type II spike-transfected and FCoV-infected target cells, they did not cross-react with Type I FCoV spike, predictably matching the binding pattern observed with the parental 18A7.4 mAb. While this still demonstrates a proof of concept, it is limited in its broader clinical use as the Type I serotype accounts for a majority of the clinical cases. However, in collaboration with the Whittaker lab, we have demonstrated that 18A7.4 recognizes the spike protein of FCoV-23, the novel and highly pathogenic Type II strain that recently accounted for an outbreak in Cyprus, thus demonstrating that these CAR constructs may already have clinical relevance. Furthermore, through this collaboration we are currently developing a monoclonal towards Type I spike, which we could generate an ScFv from and combine with the 18A7.4 ScFv to generate a more clinically relevant product. If all components of the CAR are felinized, this would mitigate risk of host immune 138 rejection such as development of feline anti-mouse antibodies directed towards the ScFv normally containing murine proteins. However, felinizing the ScFv by mutating the framework regions could potentially diminish ScFv stability and affinity for spike, and thus it may be more practical to first keep the original ScFv and modify it as needed should clinical testing demonstrate poor persistence of the cells due to host rejection, as these cells could persist in vivo for months to years.13,14 Nucleofection of IVT mRNA encoding EGFP was successful in primary feline T cells using two different programs and was significantly more efficient than plasmid. This could have application towards expressing gene editing tools such as CRISPR or TALEN in the primary T cells. However, nucleofection of larger mRNA may need to be optimized, as I was unable to nucleofect mRNA encoding a CAR, which could be due to the larger size of the CAR mRNA relative to EGFP but also be due to mRNA quality. Generating a large batch of high-quality mRNA to test may help in optimizing this process. 4.4 Research Impact This thesis has successfully demonstrated that feline T cells can be cultured and engineered for cell therapy, and that CAR T cell therapy represents a promising modality to treat FIP. Although veterinarians can now prescribe compounded GS- 441524 for FIP patients in lieu of approved FIP therapies as well as the acutely fatal course of the disease, a single antiviral is likely to lead to the selection of resistant 139 strains in the near future. Although some regimens suggest combining GS-441524 with its approved pro-drug form Remdesivir,15,16 this does not mitigate the issue of resistance as these two drugs work by the same mechanism of inhibiting the viral RNA-dependent RNA polymerase (RdRp) by competing with nucleoside triphosphates once phosphorylated within cells for incorporation into the nascent RNA, resulting in RdRp stalling and chain termination of the RNA.17–19 More recent studies have investigated treating with a different nucleoside analog, molnupiravir.20,21 Molnupiravir is chemically and mechanistically different than Remdesivir/GS-441524 in that is an N-hydroxycytidine prodrug rather than an adenine C-nucleoside and induces mutations in the transcribed viral RNA genome rather than chain termination, but ultimately it still targets the viral RdRp and has questionable efficacy.22,23 Thus, these results demonstrate that CAR T cell therapy may be a feasible alternative to the conventional small molecule antivirals for the treatment of FIP. For a streamlined approval process, it would likely be more favorable to test the CAR T cell product alone rather than in combination with small-molecule antivirals as a combinatorial product would have more regulatory complications than a monotherapy.24 More broadly, the protocols described here can be replicated to advance feline immunology research both for basic studies focused on feline T cells as well as preclinical studies for feline CAR T cell development. This thesis lays the groundwork to apply CAR T cell therapy for other diseases in felines such as lymphoma, the most common malignancy in domestic cats. Much of the technology utilized in human CAR T cell therapy may be adapted for use in felines if preclinical validations prove successful, 140 which would dramatically advance feline cell therapy closer to reaching the clinic without necessarily having to develop entirely new protocols. 4.5 Future Directions 4.5.1 Allogeneic cell sourcing While multiple CAR T cell products sourced autologously have been approved for humans, the six figure costs of these drugs would not be tenable for veterinary medicine. Moreover, in the context of FIP specifically, severely ill patients would likely succumb to the disease during the total time it would take to manufacture the product, aside from the fact that these patients are already lymphopenic and likely would not have enough T cells to collect to generate a product. Thus, an ideal cell therapy product for FIP would need to be sourced allogeneically from healthy donors. In the case of T cells, this would require additional engineering with gene editing tools like CRISPR or TALEN to prevent them from attacking healthy host tissue through mismatch between their endogenous TCR and host MHC. The coding sequence for feline CD3e is known,1 and because CD3e is required to complex to the TCR to ensure TCR surface stability,25,26 a knockout of CD3e should eliminate TCR expression, thus generating an allogeneic product that could be used “off the shelf.” Although some groups have also knocked out b2-microglobulin to eliminate MHC expression as a means of mitigating host rejection, this could actually be detrimental as it will make the CAR T cells susceptible to host NK-cell mediated killing through 141 the “missing self” mechanism unless an inhibitory receptor is simultaneously knocked in.27 If the ScFv portion of the CAR is derived from a mouse monoclonal antibody, then the host may reject the cells due to the presence of murine proteins. Development of canine anti-mouse antibodies in the recipient has been observed in dogs,28 and so future clinical trials of feline patients would need to monitor their serum for feline anti-mouse antibody production that could limit the persistence of the infused cells. One method of mitigating this risk would be “felinize” the ScFv, whereby the murine framework portions are replaced with feline. The risk of this strategy is that it may destabilize the ScFv, and thus stable surface expression of the CAR would need to be tested.29 While T cells are the standard “CAR drivers,” they may not be the most ideal for every disease context. One of the key side effects of CAR T cell therapy is cytokine release syndrome (CRS), a condition observed in >90% of human CAR T cell where once infused the activated CAR T cells trigger a storm of pro-inflammatory cytokines that results in vasodilation and hypotension as well as neurological symptoms that can range from headaches and aphasia in lower grade cases to seizures and cerebral edema in more severe cases.30,31 Because IL-6 has been implicated as one of the main cytokines hyper-secreted (by myeloid cells rather than the CAR T cells) in patients with CRS, clinicians have treated these patients with IL-6 receptor blocking tocilizumab, which has successfully reversed CRS without affecting CAR T cell expansion and may be combined with corticosteroids.30,32 As CAR T cell therapy has grown in clinical use over the years, academic medical centers have become more 142 experienced in monitoring and treating CRS. However, veterinary hospitals outside of those attached to academic institutions may not have the capacity to properly handle patients undergoing this side effect. For this reason, many groups in human medicine have instead turned their attention to NK cells. In human clinical trials, NK cells do not seem to induce CRS or graft vs. host, and thus have been sourced from donor samples such as cord blood.5 In my own experience, I have only been able to enrich <1x106 NK cells from a feline blood sample of approximately 5 mL, which is not sufficient to expand in a G-Rex for effector assays. Thus, the first step in using NK cells as the “CAR driver” would be sourcing a sufficient number of NK cells to start the culture, and developing methods to expand them. Large numbers of NK cells could be obtained through leukapheresis, a process in which white blood are concentrated from a donor or patient’s blood in a collection unit while allowing red blood cells, platelets, and plasma to return. This method is standard in human medicine and has been investigated in dogs as well,33–35 but currently there is no consensus protocol in cats. Optimizing and establishing an apheresis protocol in cats should allow for a significantly higher starting yield of cells to start a culture. 4.5.2 GMP cell manufacturing Cells intended to be used as a cell therapy product must be grown under GMP conditions. Ideally this would mean only using closed system machines for each part of the manufacturing process, including the apheresis, PBMC separation, enrichment, ex vivo culture, genetic engineering, and cryopreservation steps. My complete media 143 for growing primary feline T cells consisted of XVIVO-15 supplemented with FBS and L-glutamine. While this formulation was fine for preclinical studies, clinical cultures would need to be free of FBS and ideally phenol red as well. A GMP-grade serum replacer could take the place of the FBS, although many of these are designed for human cell cultures. For T cells, a GMP-grade activation system such as feline- specific CD3/CD28 beads would need to be established in place of the mitogenic stimuli I used preclinically. For NK cells, the optimal basal media formulation and activating cytokine milieu would have to be investigated. It may be beneficial to use a combination of IL-12/IL-15/IL-18 at some point during the culture of the NK cells to confer a memory phenotype, as these cells may proliferate more rapidly and demonstrate enhanced effector function.36 This phenotype can be characterized by low expression of CD27 and high expression of CD43/CD11b/KLRG1, which could be analyzed by qPCR in lieu of commercially available antibodies for flow cytometry.36 The most conventional method of generating CAR T cells is through viral transduction. While this is efficient in activated T cells, generating large enough batches of virus to transduce a clinical number of cells is quite expensive,35,37 and there is a risk of insertional mutagenesis depending on where the transgene integrates into the genome.38 Therefore, targeted insertion may be a preferred strategy for CAR expression, especially if using NK cells which are comparatively less amenable to viral transduction then T cells. Using gene-editing tools like CRISPR or transcription activator-like effector nucleases (TALEN), the most efficient way to accomplish this could be through a single edit knock-in/knockout strategy. Just as CRISPR has been 144 used to knock a CAR in under control of the T cell receptor a constant TRAC promoter,39 in feline T cells this could be used to knock the CAR under CD3E promoter while knocking out CD3e expression by incorporating a stop codon at the end of donor DNA insert. This would involve electroporating the gene editing tool (ribonucleoprotein complex or mRNA) along with a donor fragment encoding the CAR. Potentially the most efficient type of donor fragment to use would be single- stranded oligo deoxynucleotide fragment, which has high efficiency for knocking in genes in combination with CRISPR or TALEN.40 The 5’ and 3’ ends of the fragment would need to be hybridized to complementary oligonucleotides to generate double stranded ends that would encode for the exact CRISPR or TALEN binding sequence and cut site. This then allows for the Cas9 enzyme or TALEN monomers to bind and cut the ends of the fragment to leave homologous ends that will match exactly to the cut site made in the genomic DNA, as has been described using CRISPR.41 4.5.3 Clinical product design for FIP In chapter 3 I generated a functional anti-spike CAR against Type II FCoV derived from mAb 18A7.4. However, because most clinical presentations are due to infection with Type I, the clinical relevance of this CAR alone may be limited. Thus, generating a Type I anti-spike CAR would have the most clinical relevance, which I have begun in collaboration with the Whittaker lab. However, due to the recent spread of Type II FCoV-23,42 our current anti-spike CAR constructs may already have clinical relevance, as it may be necessary to generate a product that has efficacy against both 145 serotypes. Given that current diagnostic strategies for FIP do not distinguish infection between the two serotypes, further demonstrating the need for an all-encompassing product (Figure 4.1). The first approach to accomplish this would be through the combination of two CAR+ populations. Half of the cultured immune cells, whether T cells or NK cells, could be engineered to express the Type I CAR, while the other half is engineered to express the Type II CAR. These populations could then be enriched and expanded separately until cryopreservation, in which they would be combined 1:1 for the final product. This approach is similar to that of the approved human CD19 CAR T cell therapy lisocabtagene maraleucel, in which CD4+ and CD8+ T cells are transduced and expanded separately, then infused sequentially at an equal dose.6 The major drawback to this strategy is that in a given patient only 50% of the CAR+ cells would actually be active if they are presumably infected with only one serotype, which would likely require a higher total dose of cells to be infused in order to achieve clinical benefit. The second approach for product design would be to engineer all of the immune cells with two separate CAR constructs that have specificity for the spike protein of either serotype, thus expressing both CARs in a bicistronic fashion. The major benefit compared to the previous approach is that all of the cells in the product should be active regardless of which serotype a patient is infected with. The drawback, however, is it would be challenging to identify and enrich cells that are stably expressing both CARs. Thus, the third approach to developing an all-encompassing product would be to generate a bi-specific anti-spike CAR in which the Type I and Type II ScFvs are tethered together in tandem in one construct.43 This approach resulted in minimal-residual disease without neurotoxicity for at least three months in 146 human relapsed/refractory B cell acute lymphoblastic leukemia patients using CD19/CD22 bispecific CAR T cells.44 The drawback to this strategy is that the efficiency of CAR expression may be lower due to the increased size of the construct, however this could be easily overcome with enrichment for surface CAR expression. Additional modifications such as membrane-bound IL-15 can be incorporated in in the construct to increase persistence, and gene editing tools can be utilized to eliminate inhibitory receptors such as PD-1.45–47 147 Figure 4.1 Proposed clinical product design of CAR+ cells for the treatment of FIP. Three different CAR+ populations against Type I and Type II spike proteins respectively, could be combined into one product. Alternatively, bi-specific CAR+ could be generated by either engineering cells with two separate CAR constructs for Type I and Type II FCoV, respectively, or by tethering ScFvs against Type I and II FCoV in tandem. Figure created in BioRender. CAR= chimeric antigen receptor, FIP= feline infectious peritonitis; ScFv= single-chain variable fragment. 4.5.4 Applications to other feline diseases Beyond FIP, this CAR cell therapy represents a promising treatment modality for other feline diseases such as lymphoma. In the case of alimentary lymphoma, the most common presentation in cats that is predominantly T cell-based,48 a potential target protein could be CCR9, which is a gut-homing marker that binds to its ligand CCL25 expressed on a gradient in the small intestine and may be upregulated on infiltrating malignant cells, as well as in circulating cells in cats with a secondary leukemia.49 Indeed, one study has demonstrated the preclinical efficacy in using human CCR9 CAR T cells to eradicate leukemic T cells.50 Alimentary lymphoma can be classified into either low grade/small cell lymphocytic (which has slow disease progression and is very responsive to steroids and chlorambucil), or high grade/large cell lymphoblastic (which is more aggressive and less responsive to chemotherapy).51 Although alimentary lymphoma is predominantly T cell based, the literature remains controversial, and B cell lymphomas may account for the majority of high grade cases.51 If this is true, it may be beneficial to employ a bi-specific CAR as mentioned in the previous section, in this case combining ScFvs against CCR9 as well as against 148 a B cell marker such as CD19. This proposed product could then be administered to eradicate both malignant T and B cells without the need for biopsy collection and immunohistochemistry to determine which population the malignancy arose from. The drawback to this strategy is that there is a possibility that that healthy T and B cells could also be targeted as they would also express these markers, which could result in a severe combined immunodeficiency-like state. This contrasts the proposed FIP CAR design, in which there is virtually no off-target risk as the spike protein will only be expressed on infected cells. To decrease the risk of targeting healthy cells, NK cells may preferred over T cells as the “CAR driver.” This is because unlike T cells, NK cells can distinguish healthy cells from malignant cells based on levels of MHC I expression. Healthy cells should have normal MHC I expression that would normally inhibit NK targeting through self-recognition, while stressed/malignant cells downregulate MHC I to evade the T cell response which makes them susceptible to NK targeting as “missing self.” 52 If NK cells are used as the “CAR driver,” it may be beneficial to utilize gene-editing tools to concurrently knock-out SIRPa, an inhibitory receptor found on macrophages and primary NK cells that binds to CD47 overexpressed on malignant cells and also expressed on T cells.52–54 The optimal design of the CAR may have to be tested empirically, as the hinge region may have to be modified to adjust the length of the immunological synapse depending on whether the ScFv binds to more membrane proximal or distal epitopes on the target antigen. For bi-specific tandem CARs, this may include testing which ScFv should be in which position. In addition to lymphoma, it is possible that CAR therapy could feasibly be tested to treat solid tumors in the near future if more research is devoted towards 149 discovering possible surface markers in feline malignancies such as squamous cell carcinoma and mammary carcinoma. This would require engineering the cells to resist the immunosuppressive tumor-microenvironment. Some strategies to accomplish this could include knocking out TGFbRII on the CAR+ cells, which should shield them from TGFb known to accumulate in the tumor microenvironment that could dampen effector function. 55 Engineering the CAR+ cells to secrete pro-inflammatory cytokines like IL-12 or IL-15 may also help modulate the tumor from “cold” to “hot” by stimulating immune cells engraftment although this would carry the risk of systemic toxicity from the cytokines.56,57 Aside from neoplasia, this same strategy could be utilized to also treat inflammatory bowel disease (IBD). IBD can be difficult to distinguish from alimentary lymphoma due the overlapping clinical signs of general gastrointestinal malaise such as vomiting, inappetence, and diarrhea, as well predominately affecting middle aged to older cats.58 Ultrasound may be a useful diagnostic when there are gastrointestinal masses present, but in the absence of masses histological examination of full thickness biopsies may be required to distinguish alimentary lymphoma from IBD, which require surgically- invasive laparotomy to obtain.59 Clonality testing of CD3+ populations is sensitive method to distinguish the two diseases, where alimentary lymphoma will have clonal or oligoclonal T cells compared to polyclonal populations in IBD, although the two diseases have been diagnosed concurrently.60 Because other cells besides T cells can be implicated in IBD, targeting a more broadly-expressed protein like CCR9 may be 150 beneficial to eliminate other inflammatory immune cell populations such as IgA+ plasma cells localizing to the small intestine.61 4.6 Concluding Remarks This thesis marks the dawn of CAR T cell therapy for felines. Hopefully, the protocols and findings described here will spark an interest in further harnessing this modality in veterinary medicine similar to the original CAR T cell studies in canines. While legitimate concerns about the cost of potential future products remain, the work that is currently underway in humans using allogenic cells can be applied to veterinary medicine to fast-track development of efficacious products that can be priced affordably for clients. For clinical trials to move forward, there will need to be robust investment from academic veterinary hospitals in developing the infrastructure to manufacture and quality control these cell therapy products under GMP conditions. For institutions connected to human hospitals, this infrastructure may already exist and thus give those institutions a head start in clinical development. I strongly believe that the initial investment of time and labor into building this infrastructure will prove to be worth it when this treatment modality becomes a first-line choice for a variety of diseases and saves the lives of innumerable feline patients. 151 REFERENCES 1. Nishimura Y, Shimojima M, Sato E, et al. Downmodulation of CD3epsilon expression in CD8alpha+beta- T cells of feline immunodeficiency virus-infected cats. J Gen Virol. 2004;85(Pt 9):2585-2589. doi:10.1099/vir.0.80102-0 2. Olsen CW, Corapi WV, Jacobson RH, Simkins RA, Saif LJ, Scott FW. Identification of antigenic sites mediating antibody-dependent enhancement of feline infectious peritonitis virus infectivity. J Gen Virol. 1993;74 ( Pt 4):745- 749. doi:10.1099/0022-1317-74-4-745 3. Corapi WV, Olsen CW, Scott FW. Monoclonal antibody analysis of neutralization and antibody-dependent enhancement of feline infectious peritonitis virus. J Virol. 1992;66(11):6695-6705. doi:10.1128/JVI.66.11.6695- 6705.1992 4. Banham AH, Lyne L, Scase TJ, Blacklaws BA. Monoclonal antibodies raised to the human FOXP3 protein can be used effectively for detecting Foxp3+ T cells in other mammalian species. Veterinary Immunology and Immunopathology. 2009;127(3-4):376-381. doi:10.1016/j.vetimm.2008.10.328 5. Liu E, Marin D, Banerjee P, et al. Use of CAR-Transduced Natural Killer Cells in CD19-Positive Lymphoid Tumors. N Engl J Med. 2020;382(6):545-553. doi:10.1056/NEJMoa1910607 6. Abramson JS, Palomba ML, Gordon LI, et al. Lisocabtagene maraleucel for patients with relapsed or refractory large B-cell lymphomas (TRANSCEND NHL 001): a multicentre seamless design study. Lancet. 2020;396(10254):839- 852. doi:10.1016/S0140-6736(20)31366-0 7. King AC, Orozco JS. Axicabtagene Ciloleucel: The First FDA-Approved CAR T-Cell Therapy for Relapsed/Refractory Large B-Cell Lymphoma. J Adv Pract Oncol. 2019;10(8):878-882. doi:10.6004/jadpro.2019.10.8.9 8. Raje N, Berdeja J, Lin Y, et al. Anti-BCMA CAR T-Cell Therapy bb2121 in Relapsed or Refractory Multiple Myeloma. N Engl J Med. 2019;380(18):1726- 1737. doi:10.1056/NEJMoa1817226 9. Tang X, Yang L, Li Z, et al. First-in-man clinical trial of CAR NK-92 cells: safety test of CD33-CAR NK-92 cells in patients with relapsed and refractory acute myeloid leukemia. Am J Cancer Res. 2018;8(6):1083-1089. 10. Milone MC, Fish JD, Carpenito C, et al. Chimeric Receptors Containing CD137 Signal Transduction Domains Mediate Enhanced Survival of T Cells and 152 Increased Antileukemic Efficacy In Vivo. Molecular Therapy. 2009;17(8):1453- 1464. doi:10.1038/mt.2009.83 11. Jones S, Peng PD, Yang S, et al. Lentiviral vector design for optimal T cell receptor gene expression in the transduction of peripheral blood lymphocytes and tumor-infiltrating lymphocytes. Hum Gene Ther. 2009;20(6):630-640. doi:10.1089/hum.2008.048 12. Bloemberg D, Nguyen T, MacLean S, et al. A High-Throughput Method for Characterizing Novel Chimeric Antigen Receptors in Jurkat Cells. Mol Ther Methods Clin Dev. 2020;16:238-254. doi:10.1016/j.omtm.2020.01.012 13. Chong EA, Ruella M, Schuster SJ. Five-Year Outcomes for Refractory B-Cell Lymphomas with CAR T-Cell Therapy. N Engl J Med. 2021;384(7):673-674. doi:10.1056/NEJMc2030164 14. Frey NV, Gill S, Hexner EO, et al. Long-Term Outcomes From a Randomized Dose Optimization Study of Chimeric Antigen Receptor Modified T Cells in Relapsed Chronic Lymphocytic Leukemia. JCO. 2020;38(25):2862-2871. doi:10.1200/JCO.19.03237 15. Taylor SS, Coggins S, Barker EN, et al. Retrospective study and outcome of 307 cats with feline infectious peritonitis treated with legally sourced veterinary compounded preparations of remdesivir and GS-441524 (2020–2022). Journal of Feline Medicine and Surgery. 2023;25(9):1098612X231194460. doi:10.1177/1098612X231194460 16. Green J, Syme H, Tayler S. Thirty‐two cats with effusive or non‐effusive feline infectious peritonitis treated with a combination of remdesivir and GS‐441524. Veterinary Internal Medicne. 2023;37(5):1784-1793. doi:10.1111/jvim.16804 17. Kokic G, Hillen HS, Tegunov D, et al. Mechanism of SARS-CoV-2 polymerase stalling by remdesivir. Nat Commun. 2021;12(1):279. doi:10.1038/s41467-020- 20542-0 18. Murphy BG, Perron M, Murakami E, et al. The nucleoside analog GS-441524 strongly inhibits feline infectious peritonitis (FIP) virus in tissue culture and experimental cat infection studies. Vet Microbiol. 2018;219:226-233. doi:10.1016/j.vetmic.2018.04.026 19. Sheahan TP, Sims AC, Graham RL, et al. Broad-spectrum antiviral GS-5734 inhibits both epidemic and zoonotic coronaviruses. Sci Transl Med. 2017;9(396):eaal3653. doi:10.1126/scitranslmed.aal3653 20. Sase O, Iwami T, Sasaki T, Sano T. GS-441524 and molnupiravir are similarly effective for the treatment of cats with feline infectious peritonitis. Front Vet Sci. 2024;11:1422408. doi:10.3389/fvets.2024.1422408 153 21. Sase O. Molnupiravir treatment of 18 cats with feline infectious peritonitis: A case series. Veterinary Internal Medicne. 2023;37(5):1876-1880. doi:10.1111/jvim.16832 22. Maas BM, Strizki J, Miller RR, et al. Molnupiravir: Mechanism of action, clinical, and translational science. Clin Transl Sci. 2024;17(2):e13732. doi:10.1111/cts.13732 23. Santi Laurini G, Montanaro N, Motola D. Safety Profile of Molnupiravir in the Treatment of COVID-19: A Descriptive Study Based on FAERS Data. J Clin Med. 2022;12(1):34. doi:10.3390/jcm12010034 24. US Food and Drug Administration. About Combination Products. December 5, 2024. https://www.fda.gov/combination-products/about-combination- products#:~:text=Because%20combination%20products%20involve%20compon ents%20that%20would,challenging%20regulatory%2C%20policy%2C%20and% 20review%20management%20challenges. 25. Kuhns MS, Davis MM. Disruption of Extracellular Interactions Impairs T Cell Receptor-CD3 Complex Stability and Signaling. Immunity. 2007;26(3):357-369. doi:10.1016/j.immuni.2007.01.015 26. Call ME, Wucherpfennig KW. Molecular mechanisms for the assembly of the T cell receptor–CD3 complex. Molecular Immunology. 2004;40(18):1295-1305. doi:10.1016/j.molimm.2003.11.017 27. Jo S, Das S, Williams A, et al. Endowing universal CAR T-cell with immune- evasive properties using TALEN-gene editing. Nat Commun. 2022;13(1):3453. doi:10.1038/s41467-022-30896-2 28. Panjwani MK, Smith JB, Schutsky K, et al. Feasibility and Safety of RNA- transfected CD20-specific Chimeric Antigen Receptor T Cells in Dogs with Spontaneous B Cell Lymphoma. Mol Ther. 2016;24(9):1602-1614. doi:10.1038/mt.2016.146 29. Chowdhury PS, Vasmatzis G. Engineering scFvs for improved stability. Methods Mol Biol. 2003;207:237-254. doi:10.1385/1-59259-334-8:237 30. Acharya UH, Dhawale T, Yun S, et al. Management of cytokine release syndrome and neurotoxicity in chimeric antigen receptor (CAR) T cell therapy. Expert Rev Hematol. 2019;12(3):195-205. doi:10.1080/17474086.2019.1585238 31. Davila ML, Riviere I, Wang X, et al. Efficacy and toxicity management of 19- 28z CAR T cell therapy in B cell acute lymphoblastic leukemia. Sci Transl Med. 2014;6(224):224ra25. doi:10.1126/scitranslmed.3008226 154 32. Grupp SA, Kalos M, Barrett D, et al. Chimeric Antigen Receptor–Modified T Cells for Acute Lymphoid Leukemia. N Engl J Med. 2013;368(16):1509-1518. doi:10.1056/NEJMoa1215134 33. Yamamoto H, Elbadawy M, Fujisaka K, et al. Evaluation of the Safety and Feasibility of Apheresis in Dogs: For Application in Metastatic Cancer Research. Animals (Basel). 2021;11(10):2770. doi:10.3390/ani11102770 34. Sekiguchi T, Vigani A, Ripoll AZ, Taylor S, Culler C, Suter SE. Clinical Application of Apheresis in Very Small Dogs Weighing <8 kg to Pediatric Patients. Ther Apher Dial. 2020;24(3):333-342. doi:10.1111/1744-9987.13432 35. Gee AP. GMP CAR-T cell production. Best Practice & Research Clinical Haematology. 2018;31(2):126-134. doi:10.1016/j.beha.2018.01.002 36. Ni J, Miller M, Stojanovic A, Garbi N, Cerwenka A. Sustained effector function of IL-12/15/18–preactivated NK cells against established tumors. The Journal of Experimental Medicine. 2012;209(13):2351-2365. doi:10.1084/jem.20120944 37. Labbé RP, Vessillier S, Rafiq QA. Lentiviral Vectors for T Cell Engineering: Clinical Applications, Bioprocessing and Future Perspectives. Viruses. 2021;13(8):1528. doi:10.3390/v13081528 38. Levine BL, Miskin J, Wonnacott K, Keir C. Global Manufacturing of CAR T Cell Therapy. Molecular Therapy - Methods & Clinical Development. 2017;4:92- 101. doi:10.1016/j.omtm.2016.12.006 39. Eyquem J, Mansilla-Soto J, Giavridis T, et al. Targeting a CAR to the TRAC locus with CRISPR/Cas9 enhances tumour rejection. Nature. 2017;543(7643):113-117. doi:10.1038/nature21405 40. Renaud JB, Boix C, Charpentier M, et al. Improved Genome Editing Efficiency and Flexibility Using Modified Oligonucleotides with TALEN and CRISPR- Cas9 Nucleases. Cell Reports. 2016;14(9):2263-2272. doi:10.1016/j.celrep.2016.02.018 41. Shy BR, Vykunta VS, Ha A, et al. High-yield genome engineering in primary cells using a hybrid ssDNA repair template and small-molecule cocktails. Nat Biotechnol. Published online August 25, 2022. doi:10.1038/s41587-022-01418-8 42. Warr A, Attipa C, Gunn‐Moore D, Tait‐Burkard C. FCoV‐23 causing FIP in a cat imported to the UK from Cyprus. Veterinary Record. 2023;193(10):414-415. doi:10.1002/vetr.3696 43. Hou AJ, Chen LC, Chen YY. Navigating CAR-T cells through the solid-tumour microenvironment. Nat Rev Drug Discov. 2021;20(7):531-550. doi:10.1038/s41573-021-00189-2 155 44. Dai H, Wu Z, Jia H, et al. Bispecific CAR-T cells targeting both CD19 and CD22 for therapy of adults with relapsed or refractory B cell acute lymphoblastic leukemia. J Hematol Oncol. 2020;13(1):30. doi:10.1186/s13045-020-00856-8 45. Ren J, Liu X, Fang C, Jiang S, June CH, Zhao Y. Multiplex Genome Editing to Generate Universal CAR T Cells Resistant to PD1 Inhibition. Clin Cancer Res. 2017;23(9):2255-2266. doi:10.1158/1078-0432.CCR-16-1300 46. Hasan AN, Selvakumar A, Shabrova E, et al. Soluble and membrane-bound interleukin (IL)-15 Rα/IL-15 complexes mediate proliferation of high-avidity central memory CD8+ T cells for adoptive immunotherapy of cancer and infections. Clin Exp Immunol. 2016;186(2):249-265. doi:10.1111/cei.12816 47. Imamura M, Shook D, Kamiya T, et al. Autonomous growth and increased cytotoxicity of natural killer cells expressing membrane-bound interleukin-15. Blood. 2014;124(7):1081-1088. doi:10.1182/blood-2014-02-556837 48. Vezzali E, Parodi AL, Marcato PS, Bettini G. Histopathologic classification of 171 cases of canine and feline non-Hodgkin lymphoma according to the WHO. Veterinary and Comparative Oncology. 2010;8(1):38-49. doi:10.1111/j.1476- 5829.2009.00201.x 49. Moore PF, Rodriguez-Bertos A, Kass PH. Feline Gastrointestinal Lymphoma: Mucosal Architecture, Immunophenotype, and Molecular Clonality. Vet Pathol. 2012;49(4):658-668. doi:10.1177/0300985811404712 50. Maciocia PM, Wawrzyniecka PA, Maciocia NC, et al. Anti-CCR9 chimeric antigen receptor T cells for T-cell acute lymphoblastic leukemia. Blood. 2022;140(1):25-37. doi:10.1182/blood.2021013648 51. Gieger T. Alimentary Lymphoma in Cats and Dogs. Veterinary Clinics of North America: Small Animal Practice. 2011;41(2):419-432. doi:10.1016/j.cvsm.2011.02.001 52. Deuse T, Hu X, Agbor-Enoh S, et al. The SIRPα–CD47 immune checkpoint in NK cells. Journal of Experimental Medicine. 2021;218(3):e20200839. doi:10.1084/jem.20200839 53. Yamada-Hunter SA, Theruvath J, McIntosh BJ, et al. Engineered CD47 protects T cells for enhanced antitumour immunity. Nature. 2024;630(8016):457-465. doi:10.1038/s41586-024-07443-8 54. Weiskopf K, Anderson KL, Ito D, et al. Eradication of Canine Diffuse Large B- Cell Lymphoma in a Murine Xenograft Model with CD47 Blockade and Anti- CD20. Cancer Immunology Research. 2016;4(12):1072-1087. doi:10.1158/2326- 6066.CIR-16-0105 156 55. Bollard CM. Adapting a transforming growth factor beta -related tumor protection strategy to enhance antitumor immunity. Blood. 2002;99(9):3179- 3187. doi:10.1182/blood.V99.9.3179 56. Liu E, Tong Y, Dotti G, et al. Cord blood NK cells engineered to express IL-15 and a CD19-targeted CAR show long-term persistence and potent antitumor activity. Leukemia. 2018;32(2):520-531. doi:10.1038/leu.2017.226 57. Koneru M, Purdon TJ, Spriggs D, Koneru S, Brentjens RJ. IL-12 secreting tumor-targeted chimeric antigen receptor T cells eradicate ovarian tumors in vivo. OncoImmunology. 2015;4(3):e994446. doi:10.4161/2162402X.2014.994446 58. Jergens AE. Feline Idiopathic Inflammatory Bowel Disease: What we know and what remains to be unraveled. Journal of Feline Medicine and Surgery. 2012;14(7):445-458. doi:10.1177/1098612X12451548 59. Evans SE, Bonczynski JJ, Broussard JD, Han E, Baer KE. Comparison of endoscopic and full-thickness biopsy specimens for diagnosis of inflammatory bowel disease and alimentary tract lymphoma in cats. Journal of the American Veterinary Medical Association. 2006;229(9):1447-1450. doi:10.2460/javma.229.9.1447 60. Lingard AE, Briscoe K, Beatty JA, et al. Low-Grade Alimentary Lymphoma: Clinicopathological Findings and Response to Treatment in 17 Cases. Journal of Feline Medicine and Surgery. 2009;11(8):692-700. doi:10.1016/j.jfms.2009.05.021 61. Lazarus NH, Kunkel EJ, Johnston B, Wilson E, Youngman KR, Butcher EC. A Common Mucosal Chemokine (Mucosae-Associated Epithelial Chemokine/CCL28) Selectively Attracts IgA Plasmablasts. The Journal of Immunology. 2003;170(7):3799-3805. doi:10.4049/jimmunol.170.7.3799 157 APPENDIX Item Manufacturer Cat # 96 well round bottom TC plate Thermo 163320 96 well V bottom TC plate Nest Scientific 701201 G-Rex 24 well plate Wilson Wolf 80192M MS column Miltenyi 130-042-201 Polypropylene 25 x 89 mm ultracentrifuge tubes Beckman Coulter 326823 0.45 μm PES syringe filter Nest Scientific 380211 Table A1. Key supplies used in experiments. 158 Item Manufacturer Cat # 0.25% Trypsin/2.21 mM EDTA in HBSS Corning 25-053-CI 1X Dulbecco's Modification of Eagle's Medium Corning 15-017-CV 1X Eagle's Modified Essential Medium Corning 10-009-CV 1X RPMI 1640 Corning 15-040-CV 200 mM L-glutamine Corning 25-005-CI AflII New England Biolabs R0520S Amaxa Human T Cell Nucleofector kit Lonza VPA-1002 Amphotericin B Gibco 15290-026 Anti-mouse IgG Microbeads Miltenyi 130-048-402 BamHI-HF New England Biolabs R3136S BbsI-HF New England Biolabs R3539S Bovine serum albumin Roche 10735086001 CellTrace Violet Thermo Scientific C34571 Concanavalin A from Canavalia ensiformis Sigma C5275-5MG EcoRI-HF New England Biolabs R3101S EDTA Corning 46-034-CI 159 EndoFree Plamsmid Maxi Kit Qiagen 12362 Feline IFN-𝛄 DuoSet ELISA R&D Systems DY764 Feline IL-10 DuoSet ELISA R&D Systems DY736 Fetal bovine serum Avantor Seradigm 97068-085 Ficoll Paque PREMIUM 1.077 g/L Cytiva 17544202 Fixation/Permeabilization Solution BD 554722 FUGENE HD Promega E2311 GeneJET Gel Extraction kit Thermo Scientific K0691 Goat serum heat inactivated Cellect 2939249 Hybridoma SFM Gibco 12045076 Ionomycin calcium salt from Streptomyces conglobatus Sigma I0634-1MG LIVE/DEAD Near IR 633 nm excitation Thermo Scientific L34975 mMessage mMachine T7 Ultra kit Thermo Scientific AM1345 NEB Stable E. coli New England Biolabs C3040H NotI-HF New England Biolabs R3189S Nu Serum IV Culture Supplement Corning 355504 160 OmniPur Phenol:Chloroform:Isoamyl alcohol 25:24:1 Sigma 6810-400ML Penicillin Streptomycin Soluton 100X Corning 30-002-CI Pfu Ultra II Fusion HS polymerase Agilent 600670 pGEM-T Easy Vector System I Promega A1360 Pierce BCA Protein Assay kit Thermo Scientific 23227 Pierce ECL Western Blotting Substrate Thermo Scientific 32209 PmeI New England Biolabs R0560S Polybrene Sigma TR-1003-50UL PowerUP SYBR Green Master Mix Applied Biosystems A25742 Protoscript II First Strand cDNA Synthesis kit New England Biolabs E6560S Puromycin 10mg/mL Invivogen CAS 58-58-2 QIAprep Spin Miniprep kit Qiagen 27104 QIAquick pCR Purification kit Qiagen 28104 Quick ligation kit New England Biolabs M2200S Recombinant feline interleukin 12 R&D Systems 1954-FL 161 Recombinant feline interleukin 2 R&D Systems 1890-FL Recombinant human interleukin 21 Peprotech 200-21-2UG Recombinant human transforming growth factor 𝛃 R&D Systems 7754-BH Recombinant shrimp alkaline phosphatase New England Biolabs M0371S SalI-HF New England Biolabs R3138S SuperScript III First Strand cDNA Synthesis kit Invitrogen 18080-051 T4 DNA ligase buffer New England Biolabs B0202S Taq polymerase Invitrogen 18038-042 TRIzol Reagent Thermo Scientific 15596018 TRIzol Reagent Invitrogen 15596026 UltraComp eBeads PLUS Thermo Scientific 01-3333-41 Vectofusin-1 Miltenyi 130-111-163 XbaI New England Biolabs R0145S XVIVO-15 + phenol red/L- glutamine/gentamicin Lonza 04-418Q Table A2. Key reagents used in experiments. 162 Item Manufacturer 7500 Fast Real Time PCR System Applied Biosystems Amaxa Nucleofector IIb Lonza Attune NxT Acoustic Focusing Cytometer Thermo Scientific Avanti JXN-26 Centrifguge Beckman Coulter BioTek Synergy H1 Plate Reader Agilent ChemiDoc MP Imaging System Bio-Rad FACS Canto II BD JA-14 Rotor Beckman Coulter Optima XPN Ultracentrifuge Beckman Coulter PTC-200 Peltier Thermal Cycler MJ Research SW32 Ti Rotor Beckman Coulter UV Spectrophotometer Q3000 Quawell Table A3. Key equipment used in experiments. 163 Target Conjugate Flow Cytometry Dilution Clone Manufacturer Cat # Feline CD4 FITC 1:10 vpg34 Bio-Rad MCA1346F Feline CD3 Unconjugated 1:16 (serum supernatant) NZM1 Yorihiro Nishimura (NIID Japan) N/A Feline CD8 PE 1:100 fCD8 Southern Biotech 8120-09 FIPV 1146 Spike Unconjugated 1:100 18A7.4 Fred Scott (Cornell) N/A FLAG Unconjugated 1:100 M2 Sigma F1804-50UG Goat anti- mouse IgG H+L AF647 1:200 Polyclonal Thermo A21236 Goat anti- mouse IgG3 AlexaFluor 488 1:200 Polyclonal Invitrogen A21151 Human CD19 FITC 1:20 HIB19 BioLegend 302205 Human CD69 APC 1:20 FN50 BD 555533 Human CD271 (LNGFR) BV421 1:20 C40-1457 BD 562562 Rhodopsin (C9) Unconjugated 1:100 1D4 Abcam ab5417 Table A4. Key antibodies used in flow cytometry experiments with dilutions. 164 Cell Supplier 18A7.4 Hybridoma Ed Dubovi (Cornell) Fcwf-4CU Gary Whittaker (Cornell) HEK293T Hector Aguillar-Carreno (Cornell) Jurkat Richard Cerione (Cornell) NZM1 Hybridoma Yorihiro Nishimura (U of Tokyo) Raji Kristy Richards (Cornell) Table A5. Cell lines utilized for experiments. 165 Plasmid Supplier Cat # CF1∆Env Eric Poeschla, U Colorado N/A Golden Gate TALEN and TAL Effector kit 2.0 Addgene (Daniel Voytas and Adam Bogdanove) 1000000024 HDM-Tat1b Gustavo Mostoslavsky, Boston U N/A HDM-VSV-G Gustavo Mostoslavsky, Boston U N/A pCDNA3.1+ Thermo Scientific V79020 pHAGE2-dsRed-ZsGreen Gustavo Mostavslasky, Boston U N/A pLenti-CMV-Zeo Addgene (Eric Campeau and Paul Kaufman) 17449 pLTR-RD114A Addgene (Jakob Reiser) 17576 pSLCAR-CD19-BBZ Addgene (Scott McComb) 135992 pTiger Addgene (Garry Nolan) 1728 Rc-CMV-Rev1b Gustavo Mostoslavsky, Boston U N/A Table A6. Key plasmids utilized for experiments.