THE GUT MICROBIOTA IN THE MURINE STRESS RESPONSE A Dissertation Presented to the Faculty of the Graduate School of Cornell University In Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy by Madalena Vaz Ferreira Real August 2025 © 2025 Madalena Vaz Ferreira Real THE GUT MICROBIOTA IN THE MURINE STRESS RESPONSE Madalena Vaz Ferreira Real, Ph. D. Cornell University 2025 An organism’s survival depends on its ability to adequately respond to changes in internal and external conditions. When these changes are particularly demanding or life- threatening, they can act as stressors. In mammals, gut-associated microbial communities have been shown to be important modulators of host responses to external chronic stressors. However, the effects of internal or acute stressors on the gut microbiota are less well understood. Additionally, while most work has focused on community-level changes, how individual microbiota members evolve in response to stressors is yet to be investigated. In Chapter 1 of this dissertation, I explored how the gut microbiota of house mice (Mus musculus domesticus) responds to host internal stressors, specifically the metabolically demanding production of major urinary proteins (MUPs). I show that deletion of the Mup gene family caused sex-specific shifts in the taxonomic and functional composition of the mouse gut microbiota, including the depletion of microbes belonging to the Ruminococcaceae family, which has previously been shown to reduce the risk of metabolic disease. In Chapter 2, I investigated how the host and its gut microbiota respond to an acute external stressor (i.e., predator-odor exposure), comparing these responses to the effects of a well-established chronic stress paradigm (i.e., social isolation). I found that brief exposure to predator odor had a greater impact on the gut microbiota of wild-derived mice than prolonged social isolation, and that the gut microbiota was a better predictor of host behavior than was host gene expression. Finally, in Chapter 3, I explored how the host’s social environment affects the evolution of gut bacterial species. I found that social isolation accelerated divergent evolution in the native gut microbiota of wild-derived mice. The summation of this work contributes to our understanding of how gut symbionts shape the host’s ability to cope with diverse challenges. iii BIOGRAPHICAL SKETCH Madalena Vaz Ferreira Real majored in Aquatic Sciences at the Abel Salazar Institute of Biomedical Sciences, at the University of Porto (Porto, Portugal). After completing her undergraduate studies in 2018, she pursued a post-graduation in Scientific Illustration, while working as a teaching assistant at her alma mater. In 2020, she became a Fulbright Fellow and was accepted as a PhD student in the Ecology and Evolutionary Biology program at Cornell University (NY, USA), under the advisership of Dr. Andrew Moeller. Since 2024, she has been visiting the department of Ecology and Evolutionary Biology at Princeton University (NJ, USA) as an IvyPlus Exchange Scholar. After her graduation in the Summer of 2025, she will start a postdoctoral position in the department of Fundamental Microbiology, at the University of Lausanne (Lausanne, Switzerland), under Dr. Philipp Engel. iv A TODOS os que me ajudaram nesta aventura. v ACKNOWLEDGEMENTS I want to gratefully acknowledge the financial support for this dissertation provided by the Fulbright U.S. Scholar Program, sponsored by the U.S. Department of State and the Portuguese Fulbright Commission. I want to clarify that its contents are solely my responsibility and do not necessarily represent the official views of the Fulbright Program, the Government of the United States, or the Portuguese Fulbright Commission. Funding was also provided by the National Institutes of Health (NIH) grant R35 GM138284-01, awarded to Dr. Andrew Moeller, and a pilot grant award under NIH Animal Models for the Social Dimensions of Health and Aging Research Network R24 AG065172, awarded to Prof. Michael Sheehan. The NIH had no role in study design, data collection and interpretation, and the contents of this dissertation are, once again, solely my responsibility, and do not necessarily represent the views of the NIH. I want to extend my sincere gratitude to my special committee—composed of Prof. Michael Sheehan, Dr. Maren Vitousek, and chaired by Dr. Andrew Moeller—without which this work would not have been possible. I also want to thank all members of the Moeller lab, past and present: my fellow graduate students, Samantha Goldman, Brian Dillard, and Abby Landers; PostDocs Jon Sanders, Brian Trevelline, Dan Sprockett, and Kate Lagerstrom; and technicians Weiwei Yan, Hannah Grazul, Nate Ennis, and Siddharth Uppal. I also want to thank undergraduate students Sylvia Bayrakdarian and Tess Reichard. Finally, I want to extend my profound gratitude to all the staff, faculty, and students at the Ecology and Evolutionary Biology Department, particularly Patty Jordan and Jennifer Holleran, for their aid, big and small, throughout my PhD program. vi TABLE OF CONTENTS BIOGRAPHICAL SKETCH ......................................................................................... iii ACKNOWLEDGEMENTS ........................................................................................... v TABLE OF CONTENTS .............................................................................................. vi LIST OF FIGURES ....................................................................................................... ix LIST OF TABLES ........................................................................................................ xi 1. MAJOR URINARY PROTEIN (MUP) GENE FAMILY DELETION DRIVES SEX-SPECIFIC ALTERATIONS ON THE HOUSE MOUSE GUT MICROBIOTA . 1 1.1. Abstract .............................................................................................................. 1 1.2. Importance ......................................................................................................... 1 1.3. Introduction ....................................................................................................... 2 1.4. Results ................................................................................................................. 4 1.4.1. Deletion of the Mup gene cluster .................................................................. 4 1.4.2. Metagenomic sequencing of Mup WT and KO mice .................................... 6 1.4.3. Mup deletion affected the taxonomic composition of the gut microbiota in males ....................................................................................................................... 6 1.4.4. Mup deletion affected the functional composition of the gut microbiota in males ....................................................................................................................... 9 1.4.5. Significant correspondence of taxonomic and functional profiles ............... 9 1.4.6. Mup deletion reduced the gut microbial diversity in males ....................... 10 1.4.7. Specific microbial taxa and functions were depleted in Mup-knockout males ..................................................................................................................... 10 1.5. Discussion ......................................................................................................... 14 1.6. Methods ............................................................................................................ 18 1.6.1. Genome Editing .......................................................................................... 18 vii 1.6.2. Animals ....................................................................................................... 19 1.6.3. Microbiota Analysis .................................................................................... 19 1.6.4. Statistical Analysis ...................................................................................... 20 2. THE MOUSE GUT MICROBIOTA RESPONDS TO PREDATOR ODOR AND PREDICTS HOST BEHAVIOR .................................................................................. 22 2.1. Abstract ............................................................................................................ 22 2.2. Importance ....................................................................................................... 23 2.3. Introduction ..................................................................................................... 23 2.4. Results ............................................................................................................... 25 2.4.1. Predator-odor exposure and social isolation gave rise to stress-associated behaviors .............................................................................................................. 25 2.4.2. Predator-odor exposure altered the transcriptome of an endocrine and immunological tissue ............................................................................................ 30 2.4.3. Predator-odor exposure had a greater impact on the gut microbiota than did social isolation ............................................................................................... 31 2.4.4. Predator-odor exposure drove persistent alterations in the relative abundances of specific SGBs ................................................................................ 33 2.4.5. Predator odor–responsive SGBs co-varied with host anti-microbial and behavioral responses ............................................................................................ 37 2.4.6. The gut microbiota was a better predictor of host behavior than was host VAT gene expression ............................................................................................ 40 2.6. Methods ............................................................................................................ 46 2.6.1. Animals ....................................................................................................... 46 2.6.2. Social Isolation ........................................................................................... 46 2.6.3. Predator Odor Exposure ............................................................................ 46 2.6.4. Behavioral Assays ...................................................................................... 47 viii 2.6.5. Host Gene Expression ................................................................................ 49 2.6.6. Gut Microbiota ........................................................................................... 50 2.6.7. Statistical Analyses ..................................................................................... 52 3. SOCIAL ISOLATION ACCELERATES EVOLUTION IN THE MURINE GUT MICROBIOTA ............................................................................................................. 54 3.1. Abstract ............................................................................................................ 54 3.2. Importance ....................................................................................................... 55 3.3. Introduction ..................................................................................................... 55 3.4. Results & Discussion ....................................................................................... 57 3.4.1. Measurable intra-specific diversity in the native mouse gut microbiota ... 57 3.4.2. Social isolation accelerates divergent evolution in the gut microbiota ..... 62 3.5. Conclusion ........................................................................................................ 65 3.6. Methods ............................................................................................................ 65 3.6.1. Animals ....................................................................................................... 65 3.6.2. Social Isolation ........................................................................................... 66 3.6.3. Metagenomic Data ..................................................................................... 66 3.6.5. Statistical Analyses ..................................................................................... 67 APPENDIX .................................................................................................................. 68 1.1. Supplemental Results ...................................................................................... 68 1.2. Supplemental Figures ...................................................................................... 69 1.3. Supplemental Tables ....................................................................................... 75 2.1. Supplemental Figures ...................................................................................... 79 2.2. Supplemental Tables ....................................................................................... 83 REFERENCES ............................................................................................................. 90 ix LIST OF FIGURES Figure 1.1. Mup deletion and experiment timeline. ....................................................... 5 Figure 1.2. Mup deletion significantly changes the gut microbial taxonomic and functional composition of mature males.. ...................................................................... 8 Figure 1.3. Mup deletion significantly shifts the abundance of various microbial taxa and functions.. .............................................................................................................. 12 Figure 2.1. Brief predator-odor exposure altered host behavior, gene expression, and the gut microbiota. ........................................................................................................ 28 Figure 2.2. Predator-odor exposure drove persistent alterations in the relative abundances of specific SGBs. ...................................................................................... 36 Figure 2.3. Predator odor–responsive SGBs co-varied with host anti-microbial and behavioral responses. .................................................................................................... 39 Figure 2.4. The gut microbiota was a better predictor of host behavior than was host gene expression. ........................................................................................................... 42 Figure 3.1. Measurable intra-specific diversity in the native mouse gut microbiota. . 61 Figure 3.2. Social isolation accelerates divergent evolution in the gut microbiota. .... 64 Figure S1.1 Mup genotype birth ratio. ......................................................................... 69 Figure S1.2. Mup deletion significantly changes the gut microbial taxonomic composition of mature males. ....................................................................................... 70 Figure S1.3. Mup deletion significantly changes the gut microbial functional composition of mature males. ....................................................................................... 71 Figure S1.4. Mup deletion significantly reduces microbial family diversity in mature males. ............................................................................................................................ 72 Figure S1.5. Mup deletion significantly reduces microbial functional diversity in mature males. ................................................................................................................ 73 Figure S1.6. Mup deletion significantly shifts the abundance of various microbial taxa. .............................................................................................................................. 74 x Figure S2.1. Pair-housed mice exposed to predator odor displayed increased sociability. .................................................................................................................... 79 Figure S2.2. Predator-odor exposure altered VAT gene expression. .......................... 80 Figure S2.3. Predator odor caused a larger mean fold-change in gene expression than did social isolation ........................................................................................................ 81 Figure S2.4. Social isolation increases SGB turnover. ................................................ 82 xi LIST OF TABLES Table 1.1. Effect of Mup genotype on microbial species and COG function composition .................................................................................................................... 7 Table 2.1. Effect of predator-odor exposure (PO) and social isolation (SI) on SGB composition .................................................................................................................. 33 Table 2.2. Taxonomic classification of SGBs that displayed a persistent response to predator-odor exposure (DA at both D22 and D30). .................................................... 35 Table S1.1. Effect of host sex on microbial taxonomic and functional composition. . 75 Table S1.2. Effect of Mup genotype on microbial taxonomic and functional composition. ................................................................................................................. 75 Table S1.3. Microbial taxonomic and functional profiles correspondence with Procrustes. .................................................................................................................... 75 Table S1.4. Effect of Mup genotype on microbial taxonomic and functional diversity. ...................................................................................................................................... 76 Table S1.5. Microbial taxa and functions showing differential abundance in WT vs. KO genotypes ............................................................................................................... 76 Table S1.6. Functional enrichment analyses with a hypergeometric test. ................... 77 Table S1.7. Power analysis of taxonomic and functional beta diversity results. ......... 78 Table S1.8. Power analysis of taxonomic and functional alpha diversity results ........ 78 Table S2.1. Results from linear mixed-effects model (LMM) showing effects of sex, predator odor (TMT), social isolation (Housing), or their interaction on mouse behavior ........................................................................................................................ 83 Table S2.2. Results from pairwise LMM showing the differences in behavior between the different stressor treatment combinations. .............................................................. 84 Table S2.3. Results from PERMANOVA and PERMDISP analyses showing the effect of predator odor (TMT) and social isolation (Housing) on the Euclidean distances of the visceral adipose tissue (VAT) transcriptome. ..................................... 85 xii Table S2.4. Significant results (FDR p-value < 0,05) from the biological pathway enrichment analyses of differentially expressed genes (DEGs) in the VAT of TMT- exposed (Pair TMT) and single-housed mice (Single H2O) when compared to unstressed controls (Pair H2O). .................................................................................... 86 Table S2.5. Results from random forest models testing the predictive power of SGB abundances at D22 and VAT transcriptome on host phenotypes. ................................ 88 Table S2.6. Summary results of predictive power (Gini Importance) of SGBs that were persistently associated with TMT exposure (DA at both D22 and D30). ........... 89 1 1. MAJOR URINARY PROTEIN (MUP) GENE FAMILY DELETION DRIVES SEX-SPECIFIC ALTERATIONS ON THE HOUSE MOUSE GUT MICROBIOTA 1.1. Abstract The gut microbiota is shaped by host metabolism. In house mice (Mus musculus), major urinary protein (MUP) pheromone production represents a considerable energy investment, particularly in sexually mature males. Deletion of the Mup gene family shifts mouse metabolism towards an anabolic state, marked by lipogenesis, lipid accumulation, and body mass increases. Given the metabolic implications of MUPs, they may also influence the gut microbiota. Here, we investigated the effect of deletion of the Mup gene family on the gut microbiota of sexually mature mice. Shotgun metagenomics revealed distinct taxonomic and functional profiles between wildtype and knockout males, but not females. Deletion of the Mup gene cluster significantly reduced diversity in microbial families and functions in male mice. Additionally, a species of Ruminococcaceae and several microbial functions, such as transporters involved in vitamin B5 acquisition, were significantly depleted in the microbiota of Mup-knockout males. Altogether these results show that major urinary proteins significantly affect the gut microbiota of house mouse in a sex-specific manner. 1.2. Importance The community of microorganisms that inhabits the gastrointestinal tract can have profound effects on host phenotypes. The gut microbiota is in turn shaped by host genes, including those involved with host metabolism. In adult male house mice, expression of 2 the major urinary protein (Mup) gene cluster represents a substantial energy investment, and deletion of the Mup gene family leads to fat accumulation and weight gain in males. We show that deleting Mup genes also alters the gut microbiota of male, but not female, mice in terms of both taxonomic and functional composition. Male mice without Mup genes harbored fewer gut bacterial families and reduced abundances of a species of Ruminococcaceae, a family that has been previously shown to reduce obesity risk. Studying the impact of the Mup gene cluster on the gut microbiota has the potential to reveal the effects of these genes on host phenotypes. 1.3. Introduction The gut microbiota has emerged as a major modulator of host phenotypes, from metabolism [1-5] to behavior [6-8], motivating the investigation of the factors that shape the gut microbiota. Hosts can influence the taxonomic and functional composition of the microbiota through various genetically based physiological processes [9]. Gene knockouts allow us to test hypotheses concerning the effects of these processes on the gut microbiota. This approach has been employed to demonstrate the effects on the microbiota of innate and adaptive immune genes [10-14]. However, the effects on the microbiota of non-immune genes related to host metabolism have only recently started to be investigated [15-17]. Major urinary proteins (MUPs) are lipocalins involved in pheromonal communication [18-21], and their production represents a major metabolic investment for house mice (Mus musculus). In this social rodent, the Mup gene family has undergone an extensive parallel evolutionary expansion, accumulating 21 distinct 3 copies in a 2.2 Mbp gene cluster on chromosome 4 [21]. The genetic diversity and dynamic expression of Mup genes allow excreted MUPs to function as individual identifiers [22-25], conveying kinship, territory, social status, sex, reproductive state, age, health, and even diet [26-31]. This communication occurs mostly through urine markings [32, 33], with MUPs constituting up to 90% of the male urinary proteome [34], a 2–8 times higher protein content than females [35]. Mup genes are also the most highly expressed genes in the liver [35], representing up to 20% of the hepatic transcriptome in mature males [36]. Male MUP expression is particularly upregulated after puberty [37, 38], when social dominance is established [39, 40]. MUP production is a considerable energy investment for mice, particularly males. MUP expression is reduced under caloric restriction [41-43] and in obese and diabetic mice [41, 44]. In addition to being affected by energy availability, MUPs also regulate house-mouse metabolism. Genetically obese and diabetic mice inoculated with a recombinant MUP display improved insulin sensitivity mediated by a reduction in glucose and lipid anabolism [44]. Conversely, sexually mature Mup-knockout (KO) males exhibit increased anabolic phenotypes relative to wildtype (WT) individuals [45]. KO males displayed higher body weight and visceral adipose tissue than WT mice, despite lower food intake and equal energy expenditure. This metabolic shift also manifested through higher circulating levels of triglycerides, free fatty acids and leptin, and an upregulation of genes associated with lipid metabolism in KO versus WT males. These results point to the profound effect of MUPs on mouse metabolism. Given the known interactions between host metabolic function and the gut microbiota [11, 15-17, 46, 47], Mup expression may indirectly impact the gut microbial community. 4 Additionally, Mup gene expression has been observed in the intestinal transcriptome of juvenile males [48] and in the duodenal proteome of adults [49], indicating gut commensals could also be in direct contact with MUPs. These possible mechanisms lead us to hypothesize that deletion of the Mup gene family may have major effects on the house-mouse microbial community, but this has yet to be tested. Here, we investigated how deletion of the Mup gene cluster impacts the gut microbiota of house mice. To answer this question, we generated a Mup-knockout line (KO; Mup-/-) with CRISPR/Cas9 and crossed it with wildtype mice (WT; Mup+/+) for multiple generations, yielding litters of mice discordant for Mup genotype. We then sequenced and compared the gut metagenomes of the homozygous progeny (KO vs WT). We hypothesized that sexually mature WT and KO mice would host distinct microbiotas, both taxonomically and functionally, and that the largest differences would be found in males. We found a sex-specific effect of the Mup knockout on the microbial taxonomic and functional profiles, demonstrating that this metabolically costly gene cluster shapes the gut microbiota of house mice. 1.4. Results 1.4.1. Deletion of the Mup gene cluster The Mup gene cluster was fully deleted using CRISPR/Cas9 to cleave upstream of Mup4 and downstream of Mup21 (Figure 1.1A). An individual’s Mup status was confirmed by genotyping ear biopsies collected at weaning. Lack of MUP production was confirmed by measuring urinary MUP levels (Figure 1.1B). Heterozygous crosses generated offspring with two copies of the Mup gene cluster (wildtypes, WT), only one 5 (heterozygotes, HT), or none (Mup knockouts, KO) at the expected Mendelian ratio (Figure S1.1). Figure 1.1. Mup deletion and experiment timeline. (A) Representation of the 2 Mbp Mup gene cluster shows the CRISPR/Cas9 sgRNA target sites (dashed lines) and the primer binding sites used for genotyping (arrows). (B) Representative SDS-PAGE stained with Coomassie Brilliant Blue shows urinary MUPs in WT mice (blue band at 20 kDa) and the absence of MUPs in KO individuals of both sexes (n = 2 mice/sex/genotype). 6 1.4.2. Metagenomic sequencing of Mup WT and KO mice MUP production is upregulated in WT males after sexual maturity [37, 38] and thus we sampled the gut microbiota by collecting fecal pellets from 12-week–old mice (87 ± 3 days old) housed in holding cages with same-sex littermates of diverse genotypes. A total of six litters were sampled. We sequenced the fecal metagenome of WT and KO mice, yielding an average of 9.63 ± 6.05 million reads/sample post-quality control and host-filtering. There were no significant differences in read count between WT and KO mice or between males and females, according to Wilcoxon tests (Holm–Bonferroni adjusted p-value = 0.90 and 0.19, respectively) and a linear mixed-effects model accounting for litter as a random effect (p-value = 0.51 and 0.59, respectively). For the alpha and beta diversity analyses, all samples were rarefied to the minimum observed value of 1 million reads/sample. Functional annotation of unrarefied reads produced 478.1 ± 295.9 thousand COG counts/sample, which were rarefied to the minimum observed value of 84.0 thousand COG counts/sample before alpha and beta diversity analyses. 1.4.3. Mup deletion affected the taxonomic composition of the gut microbiota in males To test the hypotheses that deleting the Mup gene cluster affected the composition of the gut microbiota, particularly in males, we compared the gut microbiota of sexually mature WT and KO mice. PERMANOVA analyses based on Jaccard and Bray-Curtis dissimilarities among samples’ MetaPhlAn 4 taxonomic profiles revealed that the microbiotas of males and females were significantly different (Table S1.1). Thus, we tested for significant differences between WT and KO individuals within each sex while 7 controlling for litter effects. These analyses revealed that mature WT and KO males display significantly different microbial taxonomic compositions at the species and genus (but not family) levels based on both presence-absence (Jaccard) and abundance- weighted (Bray-Curtis) beta diversity dissimilarities, even while co-housed with same- sex littermates of diverse Mup genotypes (Table 1.1; Table S1.2; Figure S1.2). This significant shift in the taxonomic makeup of the microbiota between WT and KO males was not driven by differences in dispersion between Mup genotypes, as no significant differences in taxonomic PERMDISP were observed (Table 1.1; Figure 1.2B). No significant differences were observed in females (Table 1.1; Table S1.2; Figure S1.2). Cumulatively, these results show that deletion of the Mup gene cluster caused a sex- specific directional shift in the taxonomic composition of the gut microbiota. Table 1.1. Effect of Mup genotype on microbial species and COG function composition.a Sex Dissimilarity Species COG Function PERMANOVA PERMDISP PERMANOVA PERMDISP Male Jaccard 0.037 0.273 0.021 0.046 Bray-Curtis 0.019 0.188 0.012 0.080 Female Jaccard 0.154 0.739 0.116 0.633 Bray-Curtis 0.158 0.398 0.481 0.200 a Significant results are bolded (Holm–Bonferroni adjusted p-value < 0.05). 8 F ig u re 1 .2 . M u p d el et io n s ig n if ic a n tl y c h a n g es t h e g u t m ic ro b ia l ta x o n o m ic a n d f u n ct io n a l co m p o si ti o n o f m a tu re m a le s. (A ) P ri n ci p al c o o rd in at es a n al y se s (P C o A ) sh o w t h e o rd in at ed J ac ca rd ( to p r o w ) an d B ra y -C u rt is ( b o tt o m r o w ) d is si m il ar it ie s in sp ec ie s (t ri an g le s) a n d C O G f u n ct io n ( sq u ar es ) co m p o si ti o n i n t h e fe ca l m et ag en o m e o f se x u al ly m at u re m ic e, s u p er im p o se d w it h a P ro cr u st es a n al y si s. T h e o rd in at ed p o in ts a re f ac et ed b y s ex a n d c o lo re d b y g en o ty p e, s h o w in g t h e ta x o n o m ic a n d f u n ct io n al p ro fi le s o f W T ( b lu e) a n d K O ( y el lo w ) m al e (l ef t co lu m n ) an d f em al e (r ig h t co lu m n ) m ic e. T h e p er ce n ta g e o f v ar ia ti o n i n t h e ta x o n o m ic d is si m il ar it y m at ri x e x p la in ed b y e ac h P C o a x is i s en cl o se d i n p ar en th es is . T h e P E R M A N O V A a n al y se s (c en te r b o tt o m ) in d ic at e w h et h er t h er e is a s ig n if ic an t d if fe re n ce i n t h e ce n tr o id a n d /o r d is p er si o n o f th e W T a n d K O g ro u p s fo r ea ch d is si m il ar it y m ea su re a n d s ex ( * = p -v al u e < 0 .0 5 ; n s = p -v al u e > 0 .0 5 ). ( B ) B o x p lo ts s h o w t h e sp ec ie s (t o p r o w ) an d C O G fu n ct io n ( b o tt o m r o w ) o v er la p i n t h e m ic ro b io ta o f m a tu re m al es ( le ft c o lu m n ) an d f em al es ( ri g h t co lu m n ), u si n g b o th J ac ca rd (l ef t su b -c o lu m n ) an d B ra y -C u rt is ( ri g h t su b -c o lu m n ) si m il ar it ie s. T h e P E R M D IS P a n al y se s (c en te r to p ) in d ic at e w h et h er t h er e is a s ig n if ic an t d if fe re n ce i n t h e d is p er si o n o f th e W T ( b lu e) a n d K O ( y el lo w ) g ro u p s (* = p -v al u e < 0 .0 5 ; n s = p -v al u e > 0 .0 5 ). 9 1.4.4. Mup deletion affected the functional composition of the gut microbiota in males We also tested if gene function profiles in the microbiota differed between Mup WT and KO mice. Using MG-RAST annotations based on Clusters of Orthologous Genes (COGs) (Table S1.2), we conducted the same PERMANOVA and PERMDISP analyses that were employed for the microbiota taxonomic profiles. As observed for taxonomy, the COG functional composition was significantly different between WT and KO males, but not between WT and KO females (Table 1.1; Figure S1.3). In contrast to the taxonomic results, PERMDISP indicated higher functional variation among KO males compared to WT individuals, based on Jaccard, but not Bray-Curtis, similarities (Table 1.1; Figure 1.2B). No such differences in PERMDISP were observed in females (Table 1.1; Figure 1.2B). These findings indicate mature KO males exhibited both directional shifts and increased inter-individual heterogeneity in the functional composition of the gut microbiota relative to WT mice. 1.4.5. Significant correspondence of taxonomic and functional profiles Based on the results of PERMANOVA and PERMDISP analyses (Table 1.1), we next visualized the similarities among the microbiota of WT and KO mice at both taxonomic and functional levels using Procrustes. These analyses revealed significant correspondence between taxonomic and functional profiles recovered from individual mice using Bray-Curtis but not Jaccard (Table S1.3). Within sexes, only in mature males did the taxonomic and functional configurations significantly match (Table S1.3). Plotting the superimposed taxonomic and functional compositions of mature mice 10 revealed that samples clustered by Mup genotype in males but not females (Figure 1.2A). 1.4.6. Mup deletion reduced the gut microbial diversity in males Given the observed differences in gut taxonomical and functional profiles between WT and KO males, we investigated whether the Mup knockout also affected taxonomic and functional alpha diversity. A linear mixed-effects model accounting for litter as a random effect indicated that KO males had lower diversity (Shannon) and evenness (Pielou) of microbial families, but not species or genera, than their WT counterparts (Table S1.4; Figure S1.4). Females displayed no effect of Mup genotype on taxonomic diversity (Table S1.4; Figure S1.4). We also observed differences in COG function diversity (Shannon, but not Pielou) between WT and KO males (Table S1.4; Figure S1.5). No such differences were observed in females (Table S1.4; Figure S1.5). These alpha diversity results align with our findings from the beta diversity analyses, once again showing that the Mup gene cluster deletion affected the gut microbiota diversity of mature mice in a sex-specific manner. 1.4.7. Specific microbial taxa and functions were depleted in Mup-knockout males Given that the Mup knockout affected the gut microbial taxonomic and functional composition in mature males (Figure 1.2), we next identified which specific taxa and/or COG functions differed between Mup WT and KO mice (Figure 1.3 and S1.6). Differential abundance analyses with ANCOM-BC2 detected a Ruminococcaceae species, species-level genome bin (SGB) 43260, that was present in both WT and KO 11 mice but significantly underrepresented in KO males relative to WT males (Holm– Bonferroni adjusted p-value < 0.001; Table S1.5). No taxa, including SGB43260, were differentially abundant at this significance threshold between WT and KO females (Table S1.5). Several COG functions were also underrepresented in KO males (Table S1.5). The largest fold-change in abundance was observed in the sodium (Na+)/pantothenate symporter, involved in the transport of pantothenate or vitamin B5 [50]. The most significant was component EscU of the type III secretory pathway, used by Gram-negative bacteria to inject virulence factors into host cells [51, 52]. L−asparaginase II, a periplasmic high-affinity enzyme that hydrolyses exogenous l- asparagine into l-aspartate and ammonia [53], was also highly significant. A hypergeometric test revealed that no single COG category was particularly overrepresented among the various depleted functions in KO males (Table S1.6). The microbiota of KO males was instead significantly enriched in transcriptional regulators. Here too, no functions were highly differentially abundant in the microbiota of females (Table S1.5). These results point to the sex-specific effects of the Mup gene cluster deletion on the abundances of specific taxa and functions. 12 Figure 1.3. Mup deletion significantly shifts the abundance of various microbial taxa and functions. (A) Volcano plots show the log2-transformed fold change (LFC) in the abundance of species (top row) and COG functions (bottom row) in the gut microbiota of mature male (left column) and female (right column) mice. ANCOM- BC2 analyses identified species and functions (points) that were significantly more abundant in WT (blue) or KO mice (yellow), labeled respectively with the family and species designation, and the COG Category and Function. Red lines mark the significance threshold (Holm–Bonferroni–adjusted p-value < 0.001). The y-axis indicates the -log10 transformation of the non-adjusted p-value. (B) Bar plots show the LFC in abundance of the COG functions that were significantly overrepresented in mature WT males. 13 1.4.8. Depleted COG functions were present in the SGB underrepresented in KO males Based on the results from the differential abundance analysis, which identified the Ruminococcaceae species SGB43260 and several COG functions significantly depleted in KO males, we investigated whether these COG functions were present in SGB43260. We functionally annotated the 29 metagenome-assembled genomes (MAGs) from SGB43260 in the MetaPhlAn4 reference database. The genomes had an average length of 2.4 ± 0.5 Mbp of which 80.2 ± 4.8 % were coding regions, with 2.2 ± 0.5 thousand protein-coding genes annotated. Some of these genes were annotated as COG functions depleted in KO males. The functions with the second and third largest fold-change in abundance, asparaginase and Cu/Zn superoxide dismutase, were found in 26/29 and 16/29 genomes, respectively. No Na+/pantothenate symporters, the function with the largest fold-change in abundance, were observed in any of the genomes, although a gene identified as being part of the Na+/solute symporter family was found in one of the MAGs. Although missing pantothenate-specific symporters, 24/29 MAGs had a type III pantothenate kinase, which catalyzes the first step in the pathway that converts pantothenate into coenzyme A (CoA) [54]. The COG function with the most significant differential abundance result was component EscU of the type III secretory system (T3SS), but no genes associated with this secretion system were found in the annotated genomes. These results indicate that the depletion in some, but not all, COG functions could be explained by the reduction in abundance of the Ruminococcaceae species SGB43260 in KO males. 14 1.5. Discussion We found that the presence of the Mup gene cluster in house mice significantly altered the taxonomic and functional composition of the gut microbiota. In accordance with our hypothesis, deletion of the Mup gene cluster significantly affected the gut microbiota of mature male mice, but not female mice, through a shift in composition, reduction in diversity, and depletion of microbial taxa and functions. These differences were seen even among co-housed littermates, indicating that the effects of Mup were robust to the homogenizing effect of microbial dispersal among animals sharing a cage [55, 56]. The observation that Mup deletion did not change the microbial profiles of females aligns with our hypothesis that the effect of a Mup deletion would be stronger in male mice, given the sexually dimorphic expression pattern that this gene cluster exhibits [35, 36]. Deletion of the Mup gene cluster led not only to a shift in the taxonomic and functional composition of mature males, but also an increase in inter-individual microbiota variation. The production and/or presence of MUPs at high levels may exert a parallel pressure on the microbial community of WT males, driving convergence toward a similar configuration. Mature males lacking the Mup gene cluster also exhibited decreased diversity and evenness in microbial families and gene functions. A reduction in microbial taxonomic and functional diversity is one of the hallmarks of obesity-related metabolic syndrome [3, 57, 58], and Mup KO males were previously shown to develop phenotypes associated with this syndrome, such as higher body weight, visceral adipose tissue, and circulating levels of triglycerides, free fatty acids and leptin [45]. Cumulatively, these results are consistent with a scenario in which knocking out the Mup gene cluster dysregulates mouse development and/or physiology, 15 increasing the amount of variation in functional content among individuals and reducing alpha diversity. In addition to community-level patterns, the abundance of a Ruminococcaceae species, SGB43260, was negatively impacted by the deletion of the Mup gene cluster in males, but not females. This taxon was present in several KO mice, showing that Mup presence is not required for colonization by this microbe. Ruminococcaceae have been previously associated in both mice and humans with lower body weight and reduced risk of developing metabolic syndrome [59-62]. Members of this microbial family are major producers of butyrate [63], a short-chain fatty acid (SCFA) that promotes gut health (with both anti-inflammatory and antitumoral properties [64]) and increases satiety [65]. The depletion of this taxon in Mup KO males might explain the previously observed weight gain in these animals [45], although further experiments (e.g., microbiota-transplant experiments into germ-free mice) will be required to assess this hypothesis. Several gene functions were also depleted in the gut microbiota of Mup KO males, particularly sodium-dependent transporters of pantothenate (vitamin B5) [50]. Pantothenate forms the core of CoA, an essential co-factor in cellular respiration [66] and energy metabolism, including the synthesis of SCFAs like butyrate. However, not all bacterial taxa are able to synthesize vitamin B5 de novo [67]. Several Ruminococcaceae species are auxotrophic for pantothenate [68, 69], relying on sodium- dependent transporters to acquire this essential vitamin and forming cross-feeding networks with producers [67, 70]. Functionally annotating the MAGs within SGB43260 did not reveal any pantothenate-specific symporters, although the MAGs did contain 16 kinases that can utilize pantothenate in CoA biosynthesis. Other depleted COG functions, such as asparaginase and Cu/Zn superoxide dismutase, were found in the SGB43260 MAGs. These results suggest that the decrease in abundance of certain COG functions caused by Mup deletion could be linked to SGB43260, whereas others may not reflect changes in the relative abundance of specific taxa but instead taxonomy- independent shifts in the functional profile of the microbiota. One potential caveat to the observed sex-dependent effects of Mup deletion on the house mouse microbiota is that our study may have been underpowered to detect small effects in females. However, subsampling the WT males by randomly removing one individual and reperforming all analyses indicated that significant results were still observed in iterations based on lower sample sizes (see Supplemental Results), suggesting that sampling effort alone cannot explain the disparity in results between males and females. Regardless, a priority for future work will be to test through expanded sampling whether WT and KO females also differ in the taxonomic and functional composition of their microbiota. Furthermore, lineages of WT and KO mice could be housed in separate cages over longer timescales (e.g., multiple generations), conditions which would be expected to amplify microbiota differences. Comparing the microbiota of immature WT and KO males and testing how the gut microbial composition changes when these animals reach puberty and start producing MUPs [37, 38] could distinguish between the effect of the Mup gene cluster knockout and the sex- specific differences in MUP production. In the present study, the observation that adult females, which have 2–8 times lower MUP content in their urine than do adult males 17 [35], did not display significant microbiota differences is consistent with effects of sex- specific differences in MUP production. The observed shifts in the microbiota – through a decrease in overall diversity and depletion of taxa and functions associated with host metabolic health – could in turn impact the metabolism of KO mice. It will be interesting to disentangle which aspects of the anabolic phenotype observed in Mup-knockout males are directly caused by the absence of MUP production or by the shifts in the microbial community. Reciprocally transplanting the gut microbiotas of WT and KO mice to germ-free mice with different Mup genotypes could elucidate which metabolic phenotypes are caused by the microbiota differences observed here. The role of the identified Ruminococcaceae species could be explored by inoculating KO mice with this taxon and testing for changes in host metabolic state. Additionally, it is worth investigating the mechanisms through which deletion of the Mup gene cluster affects the gut microbiota. Inoculating KO mice with recombinant MUPs [44] could help differentiate between the effects of MUP production and the role of circulating MUPs on the house-mouse gut microbial community. Our results motivate investigation of how the gut microbiota mediates MUP expression. Both male and female germ-free mice have reduced MUP transcription [71], which suggests that the presence of the gut microbiota or some of its members are necessary for normal MUP production. Investigating the interactions between MUPs, the microbiota, and metabolism will reveal the role of this sexually dimorphic gene on house-mouse physiology. 18 1.6. Methods All procedures conformed to guidelines established by the U.S. National Institutes of Health and have been approved by the Cornell University Institutional Animal Care and Use Committee (protocol #2015-0060). 1.6.1. Genome Editing The Mup gene cluster knockout with CRISPR/Cas9 on FVB x B6 hybrid mice was performed by Cornell’s Stem Cell and Transgenic Core Facility. The inbred mouse strain FVB/NJ (JAX #001800) is commonly used to generate transgenics, due to its large pronucleus and litter size [72]. B6(Cg)-Tyrc-2J/J (JAX #000058) are C57BL/6J albino mice [73]. Purified RNA (Cas9 + sgRNA; sgRNA1: GGGCCATAAGGAATGATCTTGGG; sgRNA2: GAGCTAAAGGAGACCCATATGGG) was injected into the pronucleus and cytoplasm of fertilized FVB x B6 embryos (n = 150). Embryos that advanced to 2-cell stage were transferred into pseudo-pregnant FVB x B6 females (20 embryos per recipient). The resulting offspring were genotyped with Transnetyx (Cordova, TN) using ear tissue samples collected at weaning. Real-time PCR was used to detect Mup presence, using primers that targeted the gene cluster (forward primer: ACAACCTGCCATTCTGTCTCTTAAT; reverse primer: GGCAATGAAACAAGGATTTGAGTTTTACATAT; final concentration: 900 nM). A second test confirmed Mup deletion by using primers flanking the gene cluster, as amplification is only possible if the 2.2 mbp region is absent (forward primer: 19 CAGTACTCAGGGCTTGGGATT; reverse primer: ACTGTTCTCGTGGGAATATGTATTGTGAA; final concentration: 900 nM). Successful amplification in both tests indicates a heterozygous (HT) genotype, with Mup present in one of the chromosomes and missing in the other. Wildtype (WT) individuals will only have amplification in the detection test, with only the deletion test being successful in knockouts (KO). The genotyping was phenotypically confirmed by measuring MUP concentration in the animals’ urine with sodium dodecyl sulfate– polyacrylamide gel electrophoresis (SDS-PAGE). The gel was stained with Bio-Rad’s Bio-Safe™ Coomassie brilliant blue and we used Bio-Rad’s Precision Plus Protein™ Kaleidoscope™ Prestained Protein Standards as a ladder. 1.6.2. Animals A breeding population was kept at a conventional mouse facility at Cornell University, Ithaca, NY. Heterozygous crosses generated litters of WT, HT, and KO individuals. We analyzed mice from 6 different litters (7 ± 1 pups per litter). Mice were weaned at 3 weeks of age (24 ± 3 days) and housed with same-sex siblings of diverse genotypes (2- 4 animals in a cage). Animals were kept in a 12h light:12h dark cycle, with constant room temperature and humidity (21°C, 50%). Standard chow diet and water were available ad libitum. Only WT and KO males and females were included in the analysis (n = 20; 4 WT males; 3 WT females; 6 KO males; 6 KO females). 1.6.3. Microbiota Analysis Fecal samples were collected at 12 weeks of age (87 ± 3 days). Microbial total DNA 20 was extracted using the Quick-DNA MagBead extraction kit (Zymo, Irvine, CA) and the OT-2 liquid handling robot (Opentrons, New York, NY). Library preparation followed the Hackflex protocol [74] using the same robot. Libraries were sequenced on an Illumina NextSeq 2000 (Cornell’s Biotechnology Resource Center, Ithaca, NY). The metagenomic data was quality controlled with FastQC (v0.12.1) [75], followed by trimming of the Illumina adapters (GATCGGAAGAGC) with Cutadapt (v4.1; setting: "--minimum-length 1 --nextseq-trim 20") [76], and removal of host reads with Bowtie2 (v2.5.1; setting “--very-fast”; host reference genome: GRCm39 GCF_000001635.27) [77]. The remaining reads were taxonomically profiled with MetaPhlAn4 (v4.0.6) [78] and functionally annotated with Clusters of Orthologous Croups (COGs) using MG- RAST (v4.0.3) [79]. The genomes included in SGB43260 from the MetaPhlAn4 reference database were functionally annotated with Bakta (v1.7.0) [80]. All data analyses were conducted in R (v4.2.2). Before measuring alpha and beta diversity, the library size was normalized by randomly subsampling sequences to 1 million reads/sample for the taxonomic data, and 84 thousand COG counts/sample for the functional data. The Shannon diversity index, observed richness and Pielou’s evenness metrics were measured using the microbiome R package (v1.20.0) [81]. The Jaccard and Bray-Curtis dissimilarities and Euclidean distances between samples were calculated with phyloseq (v1.42.0) [82]. All plots were created with ggplot2 (v3.4.1) [83]. All figure panels were assembled using Inkscape 1.2. 1.6.4. Statistical Analysis Data are presented as mean ± standard deviation. Group means were compared with the 21 Wilcoxon signed-rank test. A linear mixed-effects model assessed the effect of genotype on microbiota diversity, while controlling for litter as a random effect (via lmerTest v3.1 [84]). The factors (genotype, sex and/or litter) that explained the microbiota dissimilarity matrix were tested by running a PERMANOVA [85] via adonis2 and a PERMDISP [86] via betadisper (vegan v2.6 [87]). Differentially abundant taxa and/or functions were identified with ANCOM-BC 2 [88]. Enrichment/depletion in COG categories and/pathways within differentially abundant functions was tested with a hypergeometric test via phyper (stats v4.2.2). Throughout the analyses, a Holm– Bonferroni adjusted p-value < 0.05 was considered statistically significant, except for the ANCOM-BC 2 analyses, where a Holm–Bonferroni adjusted p-value < 0.001 was used. 22 2. THE MOUSE GUT MICROBIOTA RESPONDS TO PREDATOR ODOR AND PREDICTS HOST BEHAVIOR 2.1. Abstract In mammals, chronic stressors can alter gut microbial communities in ways that mediate host stress responses. However, the effects of acute stressors on the gut microbiota, and how these interact with host stress responses, are less well understood. Here, we show that acute exposure of wild-derived mice (Mus musculus domesticus) to predator odor altered the composition of the gut microbiota, which in turn predicted host behavior. We experimentally tested the individual and combined effects of brief (15-minute) exposure to synthetic fox fecal odor and prolonged (4-week) social isolation—a well- established chronic stress paradigm. Leveraging behavioral assays, transcriptomics of visceral adipose tissue, and analyses of 3,500 metagenome-assembled genomes (MAGs) generated from our data, we found significant effects of predator odor on host behavior, gene expression, and gut microbiota. Gut microbial communities and host gene expression profiles responded more strongly to brief predator-odor exposure than to prolonged social isolation. The relative abundances of predator odor–responsive bacterial species—including members of the Muribaculaceae and Lachnospiraceae— measured a week after a single predator-odor exposure were associated with host phenotypes assessed the following week, namely grooming and social behaviors and the expression of genes involved in anti-microbial defense, even after accounting for the effects of the stressors. Using random forest classifiers, we found that variation in gut-microbiota composition significantly predicted variation in behavior within treatment groups. These results indicate interactions between the gut microbiota and the responses of wild-derived mice to the threat of predation, and ecologically relevant 23 acute stressor. 2.2. Importance Stress is an inherent part of animals’ lives, affecting not only physiology and behavior but also the community of microorganisms that reside within the gastrointestinal tract. The gut microbiota has been shown to influence how hosts respond to chronic stressors, but less is known about gut-microbiota effects on responses to acute stressors. We found that a 15-minute exposure to predator odor had greater impacts on the mouse gut microbiota than did 4 weeks of social isolation—a commonly used chronic stressor. Independent of stressor treatment, the gut microbiota significantly co-varied with mouse behavior measured days later. These results show that the acute threat of predation reshapes the mouse gut microbiota in persistent ways that predict host behavioral responses. 2.3. Introduction Animals are faced with diverse stressors that vary in duration and intensity [89-91], giving rise to distinct physiological and behavioral responses [92-95]. In mammals, behavioral [96-98], endocrine [99, 100], and immune [96, 101, 102] stress responses are mediated in part by the community of host-associated microorganisms that reside in the gastrointestinal tract, i.e., the gut microbiota [103], which is shaped by changes in the internal and external host environment [98, 104-108]. Recent work has shown that chronic stressors, such as social isolation, can alter the gut microbiota in ways that mediate host stress responses [109-111]. In contrast, the effects of acute stressors on the gut microbiota, and the relationships between the gut microbiota and host responses to acute stress, remain less well-understood. 24 In rodents, the threat of predation represents an intense acute stressor, and animals have evolved to use environmental cues, such as predator-odor marks, to adjust their behavior and avoid predator encounters [112]. Previous work in mice has shown that a single brief exposure to synthetic fox fecal odor 2,5-dihydro-2,4,5- trimethylthiazoline (TMT) can lead to long-lasting behavioral changes, such as increased fearfulness [113-117]. However, the effects of acute exposure to predator odor on the gut microbiota, and the extent to which predator odor–induced changes in the gut microbiota interact with host stress responses, have yet to be investigated. Here, we tested the effects of acute exposure to predator odor on the gut microbiota, gene expression, and behavior of wild-derived house mice (Mus musculus domesticus) and contrasted these effects with those of social isolation, a well- established chronic stress paradigm [21, 22]. We longitudinally sampled the gut microbiota of males and females exposed to predator odor for 15 minutes at the beginning of the third and fourth weeks of the experiment or socially isolated for 4 weeks. These wild-derived mice retain a more diverse gut microbiota than do lab mice and have recently been proposed as a solution to the microbiota-related issues around the poor reproducibility and low translational value of laboratory mouse studies [118, 119]. We found that brief exposure to predator odor had a greater impact on the gut microbiota than did prolonged social isolation. Additionally, the taxonomic composition of the gut microbiota, but not host gene expression profiles, significantly predicted inter- individual variation in host behavior, even after accounting for the effects of the predator-odor treatment. These findings support links between the gut microbiota and host responses to acute stressors. 25 2.4. Results 2.4.1. Predator-odor exposure and social isolation gave rise to stress-associated behaviors We compared the effects of brief exposure to predator odor to those of prolonged exposure to a social isolation—a well-established chronic stress model. All experiments were conducted using wild-derived mice originally captured in Saratoga Springs (New York, USA) in 2012 and since inbred in the lab [120-122]. At the beginning of the experiment (D0), we separated groups of 6-week-old same-sex littermates into pair- and single-housed mice (Figure 1A). Two weeks later (D15), we exposed these mice to 35 µL of either synthetic fox fecal odor (2,5-dihydro-2,4,5-trimethylthiazoline, TMT) or a control scent (deionized water, H2O) for 15 minutes. We repeated this exposure procedure the following week (D22). The full factorial design produced 9 unstressed control cages (10 male and 8 female pair-housed H2O-exposed mice), 6 predator-odor cages (6 male and 6 female pair-housed TMT-exposed mice), 8 social-isolation cages (3 male and 5 female single-housed H2O-exposed mice), and 9 cages that experienced both stressors (4 male and 5 female single-housed TMT-exposed mice). We assessed whether brief predator-odor exposure and prolonged social isolation acted as stressors in wild-derived mice by examining the effects of these treatments on host behavior with linear mixed-effects models (LMM) that accounted for sex, litter, and cage effects (Figure 1B; Table S1 and S2). We found that both stressors increased fearfulness in wild-derived mice, as both TMT-exposed (LMM p-value = 0.022) and socially isolated mice (LMM p-value = 0.048) displayed significantly reduced occupancy of the exposed central area during the open field test [123]. Mice 26 individually exposed to TMT (pairwise LMM p-value = 0.015) or socially isolated (pairwise LMM p-value = 0.041) were significantly more fearful (i.e., displayed reduced center occupancy) than unstressed controls, while mice that experienced both stressors displayed a non-significant trend toward increased fearfulness (pairwise LMM p-value = 0.067). There were no significant differences in overall locomotion between the treatment groups (predator odor: LMM p-value = 0.257; social isolation: LMM p-value = 0.588). These results confirm that, in line with previous work in lab mouse strains [92, 109, 124], predator-odor exposure and social isolation functioned as stressors that increased fear-associated behaviors in wild-derived mice. Predator-odor exposure has also been shown to lead to a reduction in self- grooming [116], which is part of a suite of behaviors that are inhibited when rodents enter a more vigilant state after the threat of predation [125]. We assessed grooming behavior with the splash test [126], where individual mice were sprayed with a palatable sucrose solution and their grooming behavior was measured for 5 minutes. We observed that social isolation, but not predator-odor exposure, significantly decreased grooming behavior (LLM p-value = 0.035), such that both socially isolated mice (pairwise LLM p-value = 0.029) and mice that experienced both stressors (pairwise LLM p-value = 0.039) spent significantly less time grooming than did unstressed controls (Figure 1B). Both brief predator-odor exposure [127] and prolonged social isolation [109, 124] have been previously reported to decrease rodent sociability, here measured by the relative time spent interacting with a social stimulus (stranger) versus a non-social stimulus (empty cup) in the three-chamber test [128]. Contrary to prior work in lab mice [127], we found that pair-housed wild-derived mice exposed to predator odor displayed 27 increased sociability, spending significantly more time interacting with the social stimulus than the non-social stimulus (paired Wilcoxon test p-value = 0.002; Figure S1) and displaying a social preference index significantly greater than zero (one-sample t- test p-value = 0.001; Figure 1B). Interestingly, the social preference of pair-housed mice exposed to TMT was significantly higher than that of their single-housed counterparts (pairwise LMM p-value = 0.009). We did not observe significant sex differences in any of the assayed behaviors (LLM p-values > 0.05). Overall, our results show that both brief exposure to predator odor and prolonged social isolation resulted in an increase in stress-related behaviors of wild-derived mice (i.e., fearfulness and, in the case of socially isolated mice, reduced self-grooming), and that predator-odor exposure in the context of pair housing increased sociability. 28 Figure 2.1. Brief predator-odor exposure altered host behavior, gene expression, and the gut microbiota. (A) The diagram shows the experiment timeline. Same-sex littermates of wild-derived mice (Mus musculus domesticus) were either pair or single- housed for approximately 30 days. Mice from both housing groups were exposed to either water (H2O) or predator odor (TMT) for 15 minutes on days 15 and 22 of the experiment. Fecal samples for metagenomic analyses were collected on days 0, 15, 22, and 30. At the end of the experiment, mouse behavior was assayed over three consecutive days (OFT, open-field test; ST, splash test; 3CT, three-chamber test), after which, mice were sacrificed and their visceral adipose tissue (VAT) collected for transcriptomic analyses. The embedded table shows the number of male (triangles) and female (squares) replicate cages per treatment group. (B) Box plots show the amount of time that male (triangles) and female (squares) mice of different treatment groups spent occupying the central area of the open-field test (OFT), the time spent grooming after being sprayed with a 10% sucrose solution in the splash test (SP), and the social preference index measured during the three-chamber test (3CT). Differences between the groups were tested with a pairwise comparison of the marginal means from a linear mixed-effects model (LMM) accounting for sex, litter and cage effects (* = p-value < 0.05). In the 3CT plot, we also tested whether the social preference index within each group significantly differed from zero with a one-sample t-test (** = p-value < 0.01). Dashed gray lines indicate the unstressed controls’ mean. (C) Principal coordinate analysis (PCoA) shows the first two axes of the ordinated Jaccard dissimilarity matrix of species genome bins (SGBs) composition at the end of the experiment (D30). Points represent the species profiles of male (triangles) and female (squares) mice, colored by treatment group: blue, Pair H2O; yellow, Pair TMT; pink, Single H2O; orange, Single TMT. Pair-housed cage-mates are connected by a gray line. The percent variation in SGB composition explained by each axis is enclosed in parenthesis. (D) Volcano plots show the log2-transformed fold change (LFC) in the expression of genes (points) in the visceral adipose tissue (VAT) of male and female mice in response to predator-odor exposure (left) or social isolation (right). Genes in the upper-outer quadrants were differentially expressed (DEGs; absolute LFC > 1 and FDR-adjusted p-value < 0.01), and their total number is presented at the top of the plot. (E) Bar plots show the absolute LFC of genes belonging to the anti-microbial humoral response biological pathway, which was found to be significantly enriched in the DEGs of mice exposed to predator odor (left) and social isolation (right). Genes are ordered and colored by the -log10(FDR- adjusted p-value) resulting from the differential expression analysis. Gene Reg3b was not included in the social isolation plot as it was not differentially expressed. 29 30 2.4.2. Predator-odor exposure altered the transcriptome of an endocrine and immunological tissue Given the observed effects of brief exposure to predator odor and prolonged social isolation on the behaviors of wild-derived mice, we next investigated the impacts of these stressors on gene expression profiles in the visceral adipose tissue (VAT). The VAT can function as an endocrine organ, secreting adipokine hormones that protect against the development of depressive- and anxiety-like phenotypes after chronic stress and regulate negative feedback on the HPA axis [129]. The VAT also has important immune functions, harboring several immune cells and secreting pro- and anti- inflammatory cytokines [130, 131]. Both acute and chronic stress have been shown to increase gut permeability, leading to the translocation of microbes and their metabolites from the gut lumen to surrounding tissues [132]. The VAT can detect these microbial signals [133] and inhibit bacterial infection, systemic inflammation, and sepsis [134, 135] through, for example, the secretion of anti-microbial peptides (AMPs) [136, 137]. Increased inflammation in the VAT has also been shown to impact mouse behavior [138]. To investigate the interactions among this immune-endocrine organ, mouse stress responses, and the gut microbiota, we used 3’ RNA-seq to sequence the VAT transcriptomes of mice dissected at the end of the experiment (D33). In total, 35 samples met our quality threshold of over 1 million transcripts/sample, averaging 6.54 million (SD = 3.22 million) transcripts/sample. We found that TMT exposure, but not social isolation, significantly altered the VAT gene expression profile (PERMANOVA of Euclidean distances accounting for sex and litter; predator odor: p-value = 0.035; R2 = 0.047; social isolation: p-value = 31 0.097; R2 = 0.037; Figure S2; Table S3). We tested for differentially expressed genes (DEGs) between mice exposed to individual stressors and unstressed controls. We found that, compared to social isolation, predator odor led to a greater number of DEGs (absolute log2(fold change) (LFC) > 1 and FDR-adjusted p-value < 0.01; Figure 1D) and a larger mean fold-change in gene expression (Wilcoxon test p-value = 0.026; Figure S3). Interestingly, these DEGs were significantly enriched in biological pathways related to anti-microbial humoral immune responses, including those mediated by anti-microbial peptides (AMPs; FDR-adjusted p-value = 0.007; Figure 1E; Table S4). These results show that brief predator-odor exposure had a greater impact on VAT gene expression than did prolonged social isolation. 2.4.3. Predator-odor exposure had a greater impact on the gut microbiota than did social isolation We assessed the impacts of brief exposure to predator odor and prolonged social isolation on the gut microbiota by sequencing the metagenomes of fecal samples collected at the beginning (D0) of the experiment, immediately before the TMT exposures (D15 and D22), and the end of the experiment (D30; Figure 1A). Sequencing D0 and D30 samples yielded a mean of 33.6 million (SD = 5.0 million) reads/sample. Intermediate samples from D15 and D22 were sequenced at lower depth, yielding a mean of 10.0 million (SD = 2.4 million) reads/sample. We assembled and binned D0 and D30 reads into metagenome-assembled genomes (MAGs) using a custom automated workflow (MAGmaker), following previously published methods [139]. The MAGmaker workflow yielded 6,404 MAGs, 3,542 of which were high quality (>90% 32 completeness, <5% contamination). We then created a custom database of representative species-level genome bins (SGBs) by dereplicating high-quality MAGs at 95% average nucleotide identity (ANI). SGBs were classified with the Genome Taxonomy Database [140, 141], and their relative abundances in all samples were quantified using InStrain [142]. The mean mappability of our samples to the SGBs was 75.75% (SD = 3.04%), indicating that the custom-made SGB database was generally representative of the bacterial diversity in our samples. Samples were rarefied to the minimum library size before beta-diversity analyses (8,470,661 reads for D0 and D30 samples, and 3,896,354 reads for D15 and D22 samples). We tested the effects of predator-odor exposure and social isolation on the SGB profile through PERMANOVA analyses of Jaccard and Bray-Curtis dissimilarities, accounting for sex, litter, and cage effects. In contrast with previous findings that 4 weeks of social isolation altered the gut microbiota of male lab mice [109, 110], social isolation had no effect on mean SGB composition at D30 (Table 1; Figure 1C). Instead, social isolation only significantly affected Bray-Curtis dissimilarities at D22 (Table 1). We did, however, find that social isolation significantly increased the inter-host variance in the SGB composition at D30 (Jaccard PERMDISP p-value = 0.033), and socially isolated mice displayed significantly higher SGB turnover relative to pair-housed mice, as measured by the intra-individual Jaccard dissimilarity between the beginning (D0) and end (D30) of the experiment (LMM social isolation: p-value = 0.025; predator odor: p-value = 0.427; Figure S4). In contrast, TMT exposure did not significantly change the inter-individual variance in SGB profiles (Jaccard PERMDISP p-value = 0.177) but instead significantly shifted the mean SGB composition (Jaccard PERMANOVA p- 33 value = 0.016). This difference was not observed before predator-odor exposure at D0 and D15 (Table 1). Thus, predator-odor exposure drove a significant shift in the SGB profile of male and female mice sampled one week after the second TMT exposure (D30; Table 1; Figure 1C). Overall, these results indicate that two acute exposures to TMT were sufficient to shift the SGB profiles of the mouse gut microbiota, that this effect was maintained for at least one week, and that the impacts of predator-odor exposure on gut-microbiota composition were greater than those of chronic social isolation. Table 2.1. Effect of predator-odor exposure (PO) and social isolation (SI) on SGB composition.a Timepoint Stressor Jaccard Bray-Curtis p-value R2 p-value R2 D0 PO 0.691 0.013 0.122 0.016 SI 0.622 0.013 0.180 0.014 D15 PO 0.384 0.020 0.284 0.010 SI 0.990 0.010 0.588 0.007 D22 PO 0.540 0.017 0.106 0.018 SI 0.140 0.023 0.002 0.029 D30 PO 0.027 0.020 0.002 0.026 SI 0.181 0.015 0.209 0.011 a Significant results are bolded (p-value < 0.05). 2.4.4. Predator-odor exposure drove persistent alterations in the relative abundances of specific SGBs Given the observed changes in gut-microbiota composition following predator-odor exposure, we next investigated which specific microbial taxa drove these patterns. We found that a single exposure to TMT was sufficient to significantly alter the relative abundances of several SGBs (D22 absolute LFC > 1 and FDR-adjusted p-value < 0.01; 34 Figure 2A). Seven of these SGBs remained differentially abundant (DA) one week after the second TMT exposure at D30 (Table 2). These results demonstrate that a subset of SGBs in the gut microbiota of wild-derived mice displayed persistent responses to brief predator-odor exposure and prolonged social isolation. 35 T a b le 2 .2 . T ax o n o m ic c la ss if ic at io n o f S G B s th at d is p la y ed a p er si st en t re sp o n se t o p re d at o r- o d o r ex p o su re ( D A a t b o th D 2 2 an d D 3 0 ). S G B s P h y lu m C la ss O rd er F a m il y S p ec ie s S G B 0 5 1 B ac te ro id o ta B ac te ro id ia B ac te ro id al es M u ri b ac u la ce ae L ep a g el la sp . 0 0 2 3 6 1 1 5 5 S G B 0 0 2 B ac te ro id o ta B ac te ro id ia B ac te ro id al es R ik en el la ce ae A li st ip es sp . 9 1 0 5 8 7 6 7 5 S G B 0 7 4 B ac il lo ta A C lo st ri d ia O sc il lo sp ir al es O sc il lo sp ir ac ea e P el et h o m o n a s sp . 0 0 9 7 7 4 0 5 5 S G B 1 0 5 B ac il lo ta A C lo st ri d ia L ac h n o sp ir al es L ac h n o sp ir ac ea e A ce ta ti fa ct o r sp . 0 1 1 9 5 9 1 0 5 S G B 1 0 7 B ac il lo ta A C lo st ri d ia C h ri st en se n el la le s B o rk fa lk ia ce ae G a ll im o n a s sp . 9 1 0 5 8 5 5 9 5 S G B 1 0 8 B ac il lo ta A C lo st ri d ia C h ri st en se n el la le s B o rk fa lk ia ce ae C o p ro p la sm a sp . 9 1 0 5 8 3 8 5 5 S G B 1 5 8 B ac il lo ta A C lo st ri d ia L ac h n o sp ir al es L ac h n o sp ir ac ea e C A G -3 0 3 sp . 9 1 0 5 8 5 2 1 5 36 F ig u re 2 .2 . P r ed a to r- o d o r ex p o su re d ro v e p er si st en t a lt er a ti o n s in t h e re la ti v e a b u n d a n ce s o f sp ec if ic S G B s. ( A ) V o lc an o p lo ts s h o w t h e lo g 2 -t ra n sf o rm ed f o ld c h an g e (L F C ) in t h e re la ti v e ab u n d an ce s o f sp ec ie s (p o in ts ) in t h e g u t m ic ro b io ta o f m al e an d fe m al e m ic e in r es p o n se t o p re d at o r- o d o r ex p o su re ( le ft c o lu m n ) o r so ci al i so la ti o n ( ri g h t co lu m n ) a w ee k a ft er t h e fi rs t T M T ex p o su re ( D 2 2 ; to p r o w ) an d a w ee k a ft er t h e se co n d T M T e x p o su re ( D 3 0 ; b o tt o m r o w ). U p p er -o u te r q u ad ra n ts c o n ta in p o in ts co rr es p o n d in g t o d if fe re n ti al ly a b u n d an t S G B s (D E S eq 2 ; ab so lu te L F C > 1 a n d F D R -a d ju st ed p -v al u e < 0 .0 1 ), w h o se t o ta l n u m b er is p re se n te d a t th e to p o f th e p lo t. T h e th re e m o st s ig n if ic an tl y d if fe re n ti al ly a b u n d an t S G B s in e ac h q u ad ra n t ar e la b el le d . (B ) T h e p h y lo g en et ic t re e sh o w s th e ev o lu ti o n ar y r el at io n sh ip ( n u m b er o f am in o a ci d s u b st it u ti o n s) b et w ee n r ep re se n ta ti v e S G B s in o u r cu st o m d at ab as e, w it h t h e ti p s co lo re d b y b ac te ri al c la ss . T h e ri n g s sh o w d if fe re n ti al ly a b u n d an t S G B s at D 2 2 ( o u te r tw o r in g s) a n d D 3 0 ( in n er t w o r in g s) , co lo re d b y t h e st re ss o r g ro u p i n w h ic h t h ey w er e en ri ch ed : H 2 O ( d ar k b lu e) v s. T M T ( y el lo w ) an d P ai r (l ig h t b lu e) v s. S in g le ( p in k ). S G B s th at d is p la y ed a p er si st en t re sp o n se t o t h e st re ss o rs a cr o ss b o th D 2 2 a n d D 3 0 a re e n ci rc le d . 37 2.4.5. Predator odor–responsive SGBs co-varied with host anti-microbial and behavioral responses As predator-odor exposure up-regulated the expression of genes involved in AMP production, we investigated possible associations between the expression of these AMP- associated genes and the relative abundances of microbes that responded persistently to TMT exposure (DA at both D22 and D30) (Figure 3). We controlled for the effects of the stressor treatments (Pair H2O, Pair TMT, Single H2O, Single TMT) by testing these associations using partial Spearman correlations, that residualized the AMPs expression levels and the relative abundances of SGBs against the treatment group. We found that, a week after the first TMT exposure (D22), the relative abundances of SGB051— identified as Muribaculaceae species Lepagella sp. 002361155 and depleted in TMT- exposed mice—and the relative abundances of TMT-responsive SGB105 and SGB107—identified as Lachnospiraceae species Acetatifactor sp. 011959105 and Borkfalkiaceae species Gallimonas sp. 910585595, respectively—were negatively associated with all genes involved in AMP production (Spearman’s Rho < 0; FDR- adjusted p-value < 0.05). The relative abundances at D22 of all other TMT-responsive SGBs showed positive associations with genes involved in AMP production, although, after correcting for multiple testing, this correlation was only significant for SGB074— identified as Oscillospiraceae species Pelethomonas sp. 009774055. These results show that, independent of the effects of stressor treatment, the relative abundances of predator odor–responsive SGBs were significantly associated with host AMP gene expression. We also tested whether the relative abundances of predator odor–responsive SGBs co-varied with host behavioral responses independently of the effects of stressor 38 treatment (Figure 3). We found that the D22 relative abundances of all predator odor– responsive SGBs but one were negatively associated with mouse social preference. Lachnospiraceae members SGB158 and SGB105, which were enriched in TMT- exposed mice, were also negatively associated with grooming behavior. These findings indicate that behavioral responses to predator-odor exposure, such as reduced grooming and social preference (particularly for single-housed mice exposed to TMT), could be partially explained by the relative abundances of TMT-responsive SGBs measured a week prior. 39 Figure 2.3. Predator odor–responsive SGBs co-varied with host anti-microbial and behavioral responses. (A) The correlation matrix shows associations between the D22 relative abundances of SGBs that were persistently associated with predator-odor exposure (differentially abundant at both D22 and D30) and host anti-microbial (AMPs) and behavioral responses. The color of the circles corresponds to Spearman’s Rho from a partial correlation test that accounted for the effects of stressor treatments. The thickness of the circle border indicates the significance level of this same correlation test, corrected for multiple comparisons (FDR). 40 2.4.6. The gut microbiota was a better predictor of host behavior than was host VAT gene expression Motivated by the observation that host phenotypes could be partially explained by the relative abundances of specific predator odor–responsive SGBs, we tested the predictive power of the entire gut microbiota. To this end, we trained a random forest model residualized against stressor treatment to predict host behavior based on SGB relative abundances at each timepoint. We tested whether inter-individual variation in the gut microbiota significantly predicted variation host behavior within treatment groups (Pair H2O, Pair TMT, Single H2O, Single TMT). This analysis asked whether, after accounting for the effects of stressor treatment, gut microbiota composition predicted future mouse behavior. The model’s performance was assessed through a 5-fold cross- validation strategy, and we conducted a permutation test to measure the statistical significance of the observed R2 values. We found that inter-individual variation in SGB relative abundances at D30 significantly predicted grooming behavior (Permutation test p-value = 0.016 and R2 = 0.021; linear regression p-value = 0.0195) and social preference (Permutation test p-value = 0.001 and R2 = 0.102; linear regression p-value = 0.0324), but not fearfulness (i.e., center occupancy; Figure 4A; Table S5). SGB relative abundances at D0, D15, or D22 were not predictive of behavior (Table S5). Of the SGBs we found to respond persistently to predator-odor exposure (DA at both D22 and D30), SGB107 and SGB158 ranked among the top half most important features for predicting grooming and social behavior (Figure 4B; Table S6). SGB105 and SGB002 were also important predictors of social preference, with the latter—identified as Rikenellaceae species Alistipes sp. 910587675—ranking in 20th place. Furthermore, we 41 found that the gut microbiota was a better predictor of host behavior than was VAT gene expression, which did not significantly predict behavioral phenotypes (Permutation test p-value > 0.1 and R2 < 0; Figure 4A; Table S5). These results indicate that the gut microbiota sampled at the end of the experiment, a week after the second TMT exposure, significantly predicted host behavioral phenotypes measured days later. 42 Figure 2.4. The gut microbiota was a better predictor of host behavior than was host gene expression. (A) The scatter plots show the relation between observed grooming (left column) and social (right column) behavior (residualized to account for the effect of stressor treatment) and the values predicted by a random forest model based on SGB relative abundances at D30 (top row) or VAT gene expression (bottom row). Points are colored by treatment group: blue, Pair H2O; yellow, Pair TMT; pink, Single H2O; orange, Single TMT. The significance of the linear regression is shown in the upper inner corner, with significant values (p-value < 0.05) in bold. (B) The bar plots show the zero-centered log10(Gini Importance) of SGBs persistently associated with predator-odor exposure (differentially abundant at both D22 and D30) for predicting grooming (left) and social (right) behaviors. The SGB importance rank order is annotated in bold, and the bars are colored blue if the SGB was among the top half most important features (the dashed line indicates the median importance value). The maximum x-axis value corresponds to the most important SGB, identified in the top right corner. 43 2.5. Discussion We found that exposure of wild-derived mice to an acute stressor—predator odor— promoted stress-associated behaviors, altered gene expression patterns in the visceral adipose tissue through the activation of the AMP-mediated anti-microbial responses, and shifted the species composition of the gut microbiota. Surprisingly, we found that brief exposure to predator odor had a larger impact on the VAT transcriptome and the gut microbiota SGB profile than did prolonged social isolation—a well-established chronic stress model previously shown to impact the gut microbiota [109, 110]. Moreover, variation in gut-microbiota composition at the end of the experiment (D30) predicted host behaviors within treatment groups (i.e., after accounting for the stressor effects). These results show that predator odor alters the murine gut microbiota and suggest links between inter-individual variation in the gut microbiota and behavioral responses in the context of predation stress. By comparing the effects of two distinct stressors and their combination on the gut microbiota, host gene expression, and behavior, our study builds on prior work that focused on the effects of individual stressors [109, 110, 143, 144]. We observed that the combination of stressors often had non-additive effects, exemplifying the context dependence of the stress response [92]. For example, we observed that pair-housed mice exposed to predator odor displayed significantly higher social preference than did their socially isolated counterparts, demonstrating that the social environment can affect the response to consequent stressors. In our case, pair-housed mice might seek out proximity with conspecifics when under the threat of predation—a behavior described as huddling [145]—while single-housed mice exposed to predator odor display the 44 asocial behavior commonly observed after chronic stressor exposure [146]. We identified both general and stressor-specific responses in hosts and their gut microbiota. For example, we observed that both stressors increased the expression of AMPs in the VAT. Interestingly, the expression of these AMPs co-varied with the relative abundances of several stressor-responsive taxa, even after accounting for stressor effects (Figure 3). For example, SGB051, which was depleted in TMT-exposed mice, was negatively associated with all genes involved in AMP production. This SGB was identified as a Muribaculaceae, a family that has been associated with anti- inflammatory markers [147-149] and found to be depleted in inflammatory bowel disease (IBD) [147, 150, 151]. Muribaculaceae produce short-chain fatty acids (SCFAs), which have been shown to stimulate mucus production and reduce inflammation [152], and members of this family also engage in cross-feeding behavior with known probiotic bacteria, such as Bifidobacterium and Lactobacillus [153]. The associations observed in our study could be due to either SGB051 growing better in the absence of AMPs or to a negative effect of this species on anti-microbial responses. One possible explanation for our results is that responses of the gut microbiota to predator odor were mediated by VAT inflammation triggered during the acute stress response. Alternatively, it is also possible that predator-odor exposure led to changes in the gut microbiota that triggered VAT inflammation. Given that both increased VAT inflammation [138] and stress-induced changes in the gut microbiota [109-111] have been previously shown to affect mouse behavior, the observed behavioral effects of stressor exposure may be mediated by signaling along the gut-brain-immune axis [154- 156]. Alternatively, the gut microbiota may interact with host behavior in a VAT- 45 independent manner, as variation in gut species composition was a better predictor of mouse sociability and grooming behavior than was the VAT gene expression profile. Understanding the mechanisms underlying the associations between the predation stress–altered microbiota, host inflammatory responses, and behavior will require controlled experiments in germ-free animals designed to test the effects of stressor- associated microbiota on mouse phenotypes that can complement previous work showing that host responses to acute stressors are microbiota-dependent [157-160]. Several results contradicted expectations based on previous literature using lab mouse strains. For example, while 4 weeks of social isolation was sufficient to alter the gut microbiota of C57BL6 males [109, 110], in our study only predator-odor exposure significantly altered the species composition of the gut microbiota. This discrepancy could be due to differences in the robustness of the gut community to perturbation, as lab mouse strains have a depleted, and potentially more volatile, gut microbiota compared to wild mice [118, 119]. Previous work has shown that wild-derived mouse lines can retain microbiota from wild populations for over a dozen generations in the lab [161]. Additionally, there is evidence that wild-derived mice are less sociable than lab mouse strains [162-164], potentially increasing their tolerance for social isolation. This hypothesis is supported by our observation that unstressed controls lack a clear social preference, whereas commonly used lab strains tend to display high sociability [165]. The significant social preference displayed by pair-housed mice exposed to predator odor similarly contradicts previous results in the literature [127]. Brief predator-odor exposure is likely also a more potent stressor for wild-derived mice than prolonged social isolation. This is supported by previous work showing wild-derived 46 mice are more readily responsive to the threat of predation (e.g., higher freezing and flight) than lab mice [166]. Thus, this work adds to a growing body of evidence motivating the incorporation of wild-derived mice into research as a biologically relevant complement to the work conducted on classic lab strains [118, 119, 162, 167]. 2.6. Methods All procedures conformed to guidelines established by the U.S. National Institutes of Health and have been approved by the Cornell University Institutional Animal Care and Use Committee (protocol #2015-0060). 2.6.1. Animals We used a wild-derived M. m. domesticus line, NY3, which was captured in Saratoga Springs (NY, USA) in 2012 and inbred in captivity [120-122]. These mice are related to the SAR/NachJ lines currently provided by the Jackson Laboratory [167]. Mice were kept on an inverted light cycle (light:10pm-10am) and all handling was conducted during the active (dark) phase using red light. Standard chow diet and water were available ad libitum. 2.6.2. Social Isolation Mice were weaned at 3 weeks of age (M = 22 days old, SD = 2) and co-housed with same-sex littermates. At 6 weeks of age (D0, mice were M = 37 days old, SD = 8), we separated co-housed same-sex littermates into pair- and single-housed mice, in a total of 8 male and 7 female mouse pairs, and 7 male and 10 female mice that were socially isolated. 2.6.3. Predator Odor Exposure Two weeks after the start of the experiment (D15; mice were M = 57 days old, SD = 5), 47 we exposed mice to synthetic fox fecal odor, 2,5-dihydro-2,4,5-trimethylthiazoline (TMT) (90% purity; BioSRQ, Sarasota, FL, USA). Mice were individually placed in an empty cage, brought to a fume hood, and a filter paper with 35 µL of either TMT or deionized water (H2O) was placed on their cage metal grid topper for 15 minutes. After the exposure period, we removed the filter paper, keeping the mice in the fume hood for an additional 15 minutes to ensure the TMT was removed from the work area. Afterwards, all mice were returned to their home cages. We exposed control mice first and the TMT-treated mice last, to ensure controls never encountered the predator odor. We repeated this exposure procedure the following week (D22; mice were M = 64 days old, SD = 5). In total, 10 males and 11 females were exposed to TMT, while 13 males and 13 females were exposed to H2O. Considering both stressors, there were 9 pair- housed H2O-exposed cages (5 male pairs and 4 female pairs), 6 pair-housed TMT- exposed cages (3 male pairs and 3 female pairs), 8 single-housed H2O-exposed cages (3 males and 5 females), and 9 single-housed TMT-exposed cages (4 males and 5 females). 2.6.4. Behavioral Assays We assayed mouse behavior on the fifth week of the experiment (M = 30 days, SD = 3), over three consecutive days. The tests were ordered from least to most disruptive, starting with the Open Field Test (OFT) [123], followed by the Splash Test (SP) [126], and ending with the Three-Chamber Test (3CT). All behavior trials were conducted between 1:00-6:00 pm, during the animals' active (dark) phase. The OFT and 3CT were conducted inside a soundproof chamber in a separate behavior room. The mice were habituated to the behavior room for at least 30 minutes. We alternated the testing order between experimental groups and wiped the behavioral apparatuses between trials with 48 70% ethanol. An infrared camera placed above the apparatuses recorded the behavior tests. All analyses were conducted by the same experimenter, who was blind to the experimental condition. 2.6.4.1. Open Field Test Mice were placed in the center of a white PVC arena (48 × 46 × 44 cm) and allowed to explore for 10 minutes. We used ToxTrac [168] to detect mouse trajectories and calculate total distance walked and time spent in the center of the arena (34 × 32 cm; ½ of the area). After the test, each mouse was housed in a new individual home cage. 2.6.4.2. Splash Test Our protocol was adapted from Nollet [169]. On the second day of behavior tests, each mouse was placed in an empty “spray” cage and sprayed on their dorsal coat with a 10% sucrose solution. Mice were then quickly returned to their home cage, and grooming behavior was measured for the following 5 minutes. We directly measured the duration of the grooming behavior by using a chronometer to time observed instances of nose/face grooming, head washing, and body grooming, as described by Kalueff and Tuohimaa [170]. 2.6.4.3. Three-Chamber Test Mice were placed in the middle chamber of a transparent plexiglass three-chamber arena for a 5-minute habituation period. We then placed an overturned wire cup on diagonally opposite corners of each side chamber. One of the cups was empty (non-social stimulus), while the other contained a stranger mouse of the same sex as the test mouse (social stimulus). The position of the stimuli was counterbalanced between trials. We allowed the test mouse to explore the arena for 10 minutes. The recorded video footage 49 was manually scored with BORIS where we logged interactions with the social and non- social stimuli following recommendations by Rein, Ma [128]. These were behaviors such as directly interacting with the stranger mouse between the cup’s wire bars and/or sniffing the cup or any protruding part of the stranger mouse (e.g., tail). Climbing on top of the cups or grooming in their proximity was not counted as an interaction. Additionally, we calculated the social preference index, which is the difference in interaction time between the social and non-social stimulus, normalized by the total time interacting with both stimuli [128]. Significantly higher interaction time with the social versus non-social stimulus was interpreted as the existence of a social preference [128]. 2.6.5. Host Gene Expression 2.6.5.1. Tissue Collection and Gross Morphometry Mice were humanely euthanized with an overdose of CO2 followed by cervical dislocation. Immediately after, we measured body mass and length (nose-tip to tail- base) and dissected the visceral adipose tissue (VAT), which was flash frozen and stored at -80°C. 2.6.5.2. Transcriptomic Sequencing Total RNA was extracted from the VAT using the RNeasy Lipid Tissue Mini Kit (Qiagen, Germantown, MD, USA). Briefly, approximately 50 mg of VAT were placed in Bead Ruptor 2 mL tubes with 2.4 mm metal beads (Omni International, Kennesaw, GA, USA) and 1 mL of QIAzol Lysis Reagent (Qiagen). The tissues were homogenized with a Bead Ruptor (Omni International) at speed 5 for 30 s. We followed the manufacturer’s instructions for the remainder of both RNeasy protocols, including the optional drying step of placing the RNeasy spin column in a new 2 mL collection tube 50 and centrifuging at full speed for 1 minute. Total RNA was eluted twice in 30 µL of RNase-free water (Qiagen). We assessed the concentration and purity of the extracted RNA with a NanoDrop Microvolume Spectrophotometer (Thermo Fisher Scientific) for all samples and with a TapeStation (Agilent Technologies, Santa Clara, CA, USA) for 10% of the samples. The 3’RNA-seq libraries were prepared at Cornell University’s Biotechnology Resource Center (BRC; Ithaca, NY, USA) and sequenced on a NextSeq 500 (Illumina). 2.6.5.3. Transcriptomic Data Processing We assessed the quality of our transcriptomic data with FastQC (v0.72.0) [75] and filtered out samples with less than 1 million reads. The remaining transcripts were aligned against the Mus musculus reference genome (GRCm39 GCF_000001635.27) using STAR (v2.7.10b; setting: --quantMode GeneCounts --outSAMtype BAM SortedByCoordinate) [171]. 2.6.6. Gut Microbiota 2.6.6.1. Fecal Collections We sequenced the metagenome from fecal samples collected at the beginning of the first (D0), third (D15), fourth (D22), and fifth (D30) weeks of the experiment. D15 and D22 samples were collected immediately before the predator-odor exposure procedure. D30 samples were collected immediately before the first behavioral assay. All fecal samples were flash frozen and stored at -80°C. 2.6.6.2. DNA Sequencing Total microbial DNA was extracted with the Quick-DNA MagBead extraction kit (Zymo, Irvine, CA, USA) using an OT-2 liquid handling robot (Opentrons, New York, 51 NY, USA). The metagenomic libraries were prepared with the TruSeq kit (Illumina, San Diego, CA, USA) at Cornell’s BRC. The D0 and D30 libraries were sequenced in a NovaSeq 6000 S4 (PE150 bp; Illumina) at the UC Davis Genome Center (Davis, CA, USA), while the D15 and D22 libraries were sequenced in a NovaSeq X (2 × 150 bp; Illumina) at Cornell’s BRC. 2.6.6.3. Metagenomic Data Processing and Analysis We processed our metagenomic samples and assembled MAGs using a custom snakemake [172] workflow (MAGmaker, available at https://github.com/CUMoellerLab/sn-mg-pipeline). Briefly, sequencing adapters were trimmed with Cutadapt (v17.4; setting: "-a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT -a GGGGGGGGGGGGGGGGGGGG -A GGGGGGGGGGGGGGGGGGGG -u 10 -U 10 --minimum-length 1 --nextseq-trim 20") [76], host reads removed with Bowtie2 (v2.5.1; setting: “--very-fast”; host reference genome: GRCm39 GCF_000001635.27) [77], and the quality of our metagenomic data was assessed with FastQC (v0.72.0) [75]. We assembled high-quality non-host reads from D0 and D30 into contiguous sequences (contigs) using Megahit (v1.2.9) [173] and assessed assembly quality with Quast (v5.2.0) [174]. We then calculated the distances between our samples using SourMash (v4.4.0) [175] and selected the 11 samples most dissimilar to all others to be used as “prototypes” against which the metagenomic reads from all samples were mapped with Minimap2 (v2.24) [176]. The resulting coverage information was input into three different binning algorithms: CONCOCT (v0.4.2) [177], MetaBAT2 (v2.15) [178], and https://github.com/CUMoellerLab/sn-mg-pipeline 52 MaxBin (v2.2) [179]. We then used DASTool (v1.1.6) [180] to select the optimal set of bins among the three binners. The resulting MAGs were quality controlled for completeness and contamination with CheckM (v1.2.2) [181] and GUNC (v1.0.6) [182]. We created a custom genome database by dereplicating high-quality MAGs (>90% completeness, <5% contamination) into 95% average nucleotide identity (ANI) species-genome bins (SGBs) using dRep (v3.4.2) [183]. We profiled these SGBs using GTDB-Tk (v2.4.0) [141]. Finally, we calculated the relative abundances of representative SGBs in our samples by mapping all metagenomic reads against our custom genome database with Bowtie2 and profiling them using InStrain (v1.8.0) [142]. The counts from our mapped reads were normalized by the genome size of the representative SGB the read mapped to and the library size of the metagenomic sample from which the read originated. We then converted these normalized counts into a relative abundances percentage. The Jaccard and Bray-Curtis dissimilarities between samples were calculated with phyloseq (v1.42.0) [82]. 2.6.7. Statistical Analyses All data analyses, except were indicated, were conducted in R (v4.2.2). Means are reported alongside standard deviations (SD). Linear mixed-effects models, controlling for litter and cage as a random effect, were implemented via lmerTest (v3.1) [84]. We tested which factors explained the microbiota dissimilarity matrix by running a PERMANOVA [85] via adonis2 and a PERMDISP [86] via betadisper, both included in vegan (v2.6) [87]. We calculated normalized counts and differential gene expression or taxa relative abundances between stressor treatments using DESeq2 (v1.42.1) [184] with LFC shrinkage using the "ashr" adaptive shrinkage estimator [185], after filtering 53 for genes or taxa with one or more counts in at least three samples. We identified biologically meaningful pathways within DEGs with a biological pathway enrichment analysis using clusterProfiler (v4.10.1) [186, 187]. We investigated whether species relative abundances significantly explained variation in behavior while controlling for stressor treatment effects with a random forest model implemented via Python’s scikit- learn (v1.6) [188]. We evaluated our model’s performance using a 5-fold cross- validation strategy, where we subset our data into 5 different “folds” and trained the model 5 times, using 4 of the folds as the training data and the remaining fold as the test data. Our performance metric (R2) was averaged across all 5 iterations. This way, each data point is used at least once to both train and test our model, and the R2 reflects the model’s performance across the entire dataset. We evaluated the statistical significance of the R2 using a permutation test, where we randomized the associations between behavior and species relative abundances and recalculated R2 for 1000 iterations, thus generating a distribution of R2 values expected under the null hypothesis that behavior is not associated with species relative abundances. We calculated a p-value by measuring the likelihood of observing the R2 resultant from our random forest in the null distribution. Lastly, we assessed the importance of individual SGBs in predicting behavior using Python’s scikit-learn (v1.6) [188]. Throughout the analyses, a p-value < 0.05 was considered statistically significant, except where otherwise indicated. All plots were created with ggplot2 (v3.4.1) [83]. All figure panels were assembled using Inkscape 1.2. 54 3. SOCIAL ISOLATION ACCELERATES EVOLUTION IN THE MURINE GUT MICROBIOTA 3.1. Abstract The mammalian gut microbiota is a key regulator of host health that can be shaped by the host’s social environment. Prior work has shown that social interactions can drive the transmission of gut bacteria between hosts, altering the taxonomic composition of the gut microbiota. However, relatively little is known about the effects of the host’s social environment on the evolution of gut symbionts. Here we show that social isolation accelerates the evolution of bacterial species in the gut microbiota of wild-derived house mice (Mus musculus domesticus). We split littermates into single-housed individuals and co-housed pairs and sequenced their gut metagenomes before and after 30 days. We quantified evolutionary rates—defined here as the amount of intra-specific genomic change—in 173 gut bacterial species through analyses of 3,500 metagenome-assembled genomes (MAGs) generated from experimental mice. Over the course of the 30-day experiment, gut bacterial species evolved significantly more in single-housed mice than in co-housed littermates. This also translated into greater intra-specific genomic divergence between socially isolated individuals and their littermates than between co- housed pairs. These results demonstrate that host’s social environment shapes the evolutionary rates and trajectories of gut bacterial species. 55 3.2. Importance Animals are frequently faced with changes in the environment to which they must respond adequately to survive and thrive. The community of microbes that inhabits the gastrointestinal tract, known as the gut microbiota, can influence host phenotypes through its own responses to environmental change. Most previous work has examined these responses at the community level, such as shifts in species abundances, but has generally overlooked changes occurring within the genomic repertoire of each microbial species. These evolutionary processes are especially understudied in complex systems, such as a multi-species host-associated community like the mammalian gut microbiota. Here, we investigated how changing the host’s social environment, by socially isolating wild-derived mice for 30 days, affected the evolution of gut microbes. We found that social isolation accelerated divergent evolution in gut microbes, which has potential consequences for host fitness. 3.3. Introduction Mammals, like all multicellular life, have evolved in a microbial world [189]. As a result, their physiology has become enmeshed with that of the microbes that reliably inhabit them [1, 189-193], coming to depend on microbial cues for phenotypic responses to changes in the environment [1, 103, 194-197]. The host’s social environment, for example, can profoundly impact the gut microbiota [198], which in turn modulates host phenotypes [109-111]. Not only are microbial lineages differentially transmitted through social contact [161, 199], but increased transmission among members of the social network homogenizes gut communities and increases their richness, while social 56 isolation limits microbial dispersal and increases inter-individual heterogeneity in gut community composition [200-203]. In social rodents, prolonged social isolation has also been shown to act as a stressor [109, 110, 204, 205], resulting in gut inflammation and an altered taxonomic composition of the gut microbiota [109, 110]. Whereas the effects of the host’s social environment on the taxonomic composition of the gut microbiota has been well-studied, relatively little is known about how the social environment of the host affects evolutionary dynamics within gut bacterial species. Bacteria in the mammalian gut microbiota have several characteristics that potentiate rapid adaptation to changes in the environment, such as short generation times [206], large population sizes [207], and high mutation [208, 209] and recombination rates [210, 211], which combine to generate high intra-specific genomic diversity [212- 215]. Recent work has begun investigating the evolution of gut microbial lineages in real time by, for example, co-culturing complex communities in vitro [216, 217] or tracking specific lineages in vivo [209, 218-222]. However, studies that measure evolutionary processes occurring simultaneously in more than a few species colonizing the gut are still rare [210, 223, 224]. Here we leveraged genome-resolved metagenomic data from male and female wild-derived mice (Mus musculus domesticus) that were socially isolated or co-housed with a littermate for 30 days to investigate how changes in the host social environment affect the evolutionary dynamics in the gut microbiota. We hypothesized that social isolation would increase the amount of intra-specific genomic change in the gut microbiota of socially isolated mice—given the change in selective environment (e.g., gut inflammation) and the limited social transmission, which may reduce the effective 57 population size of a given lineage, increasing the amount of genetic drift—ultimately increasing genomic heterogeneity in the littermate gut metacommunity. We found that social isolation accelerated the evolution of gut bacterial lineages, increasing the genomic divergence between lineages in single-housed mice and their littermates relative to the same lineages in co-housed pairs. These results show that the host social environment impacts evolutionary dynamics in the gut microbiota. 3.4. Results & Discussion 3.4.1. Measurable intra-specific diversity in the native mouse gut microbiota We investigated the effects of social isolation on the evolution of bacterial lineages in the gut microbiota of wild-derived mice by leveraging a genome-resolved metagenomic dataset generated in Chapter 2. Briefly, 6-week-old littermates were co-housed or single-housed for 30 days. We sequenced fecal samples collected at the beginning (D0) and end (D30) of the experiment, yielding on average 33.6 million (SD = 5.0 million) reads/sample. We assembled and binned our reads into metagenome-assembled genomes (MAGs) using a custom workflow [139], resulting in a total of 6,404 MAGs, over half of which were high-quality (3,542 MAGs with >90% completeness and <5% contamination). We then created a custom database with 173 representative species- level bins (SGBs), comprised of high-quality MAGs de-replicated at 95% average nucleotide identity (ANI) and classified with the Genome Taxonomy Database (GTDB) [140, 141]. Our database contained representatives of 15 distinct bacterial orders (Figure 3.1A). We profiled our samples by mapping all sequenced reads to our custom SGB database, with a mean of 75.75% (SD = 3.04%) mapped reads per sample, indicating 58 that our custom database was broadly representative of the genomic diversity in the full dataset. We then used InStrain [142] to calculate the abundance of our representative SGBs in each sample and quantify their intra-specific genomic diversity. The latter was achieved by using InStrain Compare to calculate popANI: the average nucleotide distance between two samples for a genome, considering only as differences genomic positions where none of the population alleles were shared. For each of our SGBs, we created a distance matrix of popANI values between our samples and identified strains by creating hierarchical clusters at 99.999% ANI. These analyses allowed us to compare the degree of genomic similarity of dominant strains among pairs of samples. We found the native gut microbiota of wild-derived mice displayed measurable intra- specific genomic diversity (Figure 3.1A), with SGBs in our dataset clustering on average into 22.24 (SD = 22.26) distinct strains. The number of unique strains per SGB varied between taxonomic groups, with Clostridia bacteria, such as SGBs in the order Oscillospirales and Lachnospirales, containing more strains per SGB than SGBs in the order Bacteroidales (Figure 3.1C; Kruskal-Wallis test p-value < 0.001; post-hoc Dunn’s test FDR-adjusted p-value < 0.05). We also found significant variation in the prevalence of strains in the metacommunity (Figure 3.1A). While most strains for each SGB were found in only one sample, 30 strains were found in 50 or more samples, and 7 SGBs contained a single dominant strain that was found in all samples (Figure 3.1B). All the latter SGBs belonged to the order Bacteroidales, which, along with SGBs from order Christensenellales, displayed significantly higher mean strain prevalence than SGBs from other orders (Figure 3.1C; Kruskal-Wallis test p-value < 0.001; post-hoc Dunn’s test FDR-adjusted p-value < 0.05). The mean prevalence of strains in each SGB was 59 positively associated with that SGB’s mean relative abundance (Figure 3.1D; linear regression p-value < 0.001 and R2 = 0.47), with SGB103, identified as the Bacteroidales Alistipes muris, displaying the highest mean relative abundance (M = 6.19%, SD = 2.04%) and containing a single dominant strain found in all samples. Bacteroidales bacteria have been shown to be aerotolerant [225], which may promote dispersal and enable strains to proliferate to every host patch in the metacommunity, as was observed for 7 Bacteroidales SGBs (Figure 3.1B). In contrast, members of the class Clostridia, such as Oscillospirales and Lachnospirales, are obligate anaerobes [226, 227], which may limit their dispersal through the metacommunity and promote intra-specific diversity (higher number of unique strains per SGB). Additionally, the observed positive association between an SGB’s relative abundance and the prevalence of its strains (Figure 3.1D) indicates that abundant species increase their dispersal potential or, alternatively, that good dispersers are also better competitors in the gut of individual hosts. Overall, these results show high inter-specific variation in the amount of intra- specific diversity in the native gut microbiota of house mice that is potentially associated with bacterial lifestyle. 60 61 Figure 3.1. Measurable intra-specific diversity in the native mouse gut microbiota. (A) The phylogenetic tree shows the evolutionary relationship (amino acid substitutions) between representative SGBs in our custom database. Tips are colored by order. The bar plots show, from left to right, the mean relative abundance (%) of each SGB across all samples, the number of strains within each SGB (number of distinct 99.999% ANI clusters), and the mean strain prevalence within each SGB (average number of samples strains were observed in), colored by order. (B) The histogram shows the total strain prevalence in our samples, with the total number of strains (×103) observed in a given number of samples. The embedded tiles indicate SGBs containing strains that were observed in at least 50 samples (grey dashed line) or in all samples (red dashed line). Tiles are colored by order and labeled with the SGB the strain belonged to. (C) The box plots show the number of strains per SGB (left) and the mean strain prevalence per SGB (right) in orders with more than one representative SGB. Significant pairwise comparisons are denoted with different letters (Dunn’s test BH-adjusted p-value < 0.05). (D) The scatter plot shows the association between the mean SGB relative abundance (%) and the mean prevalence of strains within that SGB, colored by order. The linear regression’s p-value and R2 are annotated at the top. 62 3.4.2. Social isolation accelerates divergent evolution in the gut microbiota We next investigated the effects of social isolation on the evolution of gut commensals. We hypothesized that social isolation would accelerate the evolution of gut commensals, given the changes in the gut environment and the disruption of social transmission. We tested this hypothesis by calculating the average intra-individual genomic divergence (1 – popANI) in a given SGB between the beginning (D0) and end (D30) of the experiment. We found that SGBs in single-housed mice underwent, on average, a significantly greater amount of genomic change over the 30 days of the experiment than did their conspecifics in co-housed mice (Figure 3.2A; paired Wilcoxon signed-rank test p-value = 0.006), such that a majority of SGBs (57.36%) displayed higher mean genomic divergence in single-housed mice than in co-housed mice. Additionally, we identified 15 SGBs whose mean intra-individual genomic divergence in single-housed mice was greater than 0.001%. These likely represent strain replacement events. These SGBs were on average 3.5 times more genomically diverged in socially isolated mice than their conspecifics in co-housed mice. Interestingly, all these SGBs, except for the Bacteroidales SGB082, were members of the class Clostridia. As previously mentioned, these bacteria are obligate anaerobes [226, 227], making it unlikely that the observed replacement events result from the invasion of strains from the broader environment. Instead, it is possible that these strains were at very low abundance at D0 but became the dominant strain after 30 days of social isolation. These results show that social isolation significantly accelerated the intra-host evolution of bacterial species in the gut microbiota, likely through selection on standing strain variation, and that this effect was particularly noticeable in obligate anaerobes. 63 Given our observation that SGBs in single-housed mice undergo greater evolutionary change than their conspecifics in co-housed mice, we investigated the effects of social isolation on SGB divergence between different individuals. We hypothesized that social isolation reduces dispersal opportunities for bacteria in the gut microbiota, particularly those that rely on social transmission. This would create a subdivision of the gut metacommunity of littermates, with SGBs transmitted between co-housed littermates remaining more genomically similar but becoming increasingly diverged from their conspecifics in single-housed littermates. We tested this hypothesis by calculating the mean genomic divergence in the same SGB within co-housed littermates and between single-housed and co-housed littermates. We found that, by end of the 30-day experimental period, SGBs in single-housed mice were significantly more genetically diverged from conspecifics in co-housed mice than the same SGBs in co- housed mice were to each other (Figure 3.2B; paired Wilcoxon signed-rank test p-value = 0.033). Crucially, there were no such differences at D0. Additionally, conspecific SGBs in different single-housed littermates were also significantly more diverged than conspecific SGBs in co-housed mice (Figure 3.2B; paired Wilcoxon signed-rank test p- value = 0.002). Thus, social isolation caused SGBs not only to diverge from those in co-housed littermates, but also from those in other socially isolated mice. These results indicate that social isolation increased the genomic diversity without parallel evolution between conspecific bacteria in different hosts, while co-housing homogenized and stabilized the intra-specific genomic diversity of the gut microbiota. 64 Figure 3.2. Social isolation accelerates divergent evolution in the gut microbiota. (A) The box plot shows the mean genomic divergence (1 – popANI) within the same SGB between the beginning (D0) and end (D30) of the experiment in co-housed (blue) and single-housed mice (pink). Each point represents an SGB, colored by order. SGBs are connected to their conspecific in the other housing group by a line, colored pink if the SGB shows on higher divergence in single-housed mice, or blue if higher in co- housed mice. The dashed grey line indicates our strain-clustering threshold (99.999% ANI), meaning that points above this value represent strain replacement events. The p- value resulting from a paired Wilcoxon signed-rank test is shown at the top. (B) The box plots show the mean genomic divergence between conspecific SGBs in co-housed mice (blue), single- and co-housed mice (violet), and single-housed mice (pink), at the beginning (D0) and end (D30) of the experiment. SGBs (points) are colored by order and connected across comparisons by a grey line. The p-values resulting from paired Wilcoxon signed-rank tests are shown at the top. 65 3.5. Conclusion We leveraged a previously created genome-resolved metagenomic longitudinal dataset to investigate the effects of social isolation on the evolution of gut microbes. We found that the native gut microbiota of house mice hosts extensive intra-specific diversity, which varied between taxonomic groups with differing lifestyles and dispersal potentials. Additionally, we found that this intra-specific diversity was increased by single-housing mice, such that social isolation accelerated the genomic evolution of gut bacteria. Interestingly, this genomic change did not occur in parallel. Instead, social isolation led bacterial lineages on divergent evolutionary trajectories, further increasing intra-specific diversity in the metacommunity—likely impacting the host’s ability to cope with novel challenges. 3.6. Methods 3.6.1. Animals The mice used in this experiment belonged to a wild-derived M. m. domesticus line captured in Saratoga Springs (NY, USA) in 2012 and inbred in captivity since [167]. We kept mice on an inverted light cycle (light:10pm-10am), with all handling conducted during the active (dark) phase under red light. Standard chow diet and water were available ad libitum. All procedures conformed to guidelines established by the U.S. National Institutes of Health and have been approved by the Cornell University Institutional Animal Care and Use Committee (protocol #2015-0060). 66 3.6.2. Social Isolation We weaned mice at 3 weeks of age (M = 22, SD = 2 days) and co-housed them with same-sex littermates. At 6 weeks of age (M = 43, SD = 6 days), littermates were separated into single- and co-housed mice, in a total of 8 male and 7 female co-housed pairs, and 7 male and 10 female single-housed mice. They remained under these housing conditions for the following 30 (SD = 3) days. As part of Chapter 2, half of the mice were exposed to an additional stressor (predator odor), while the other half were used as controls (5 male and 4 female co-housed pairs, and 3 male and 5 female single-housed mice). We collected fecal samples at the beginning (D0) and end of the experiment (D30) and stored them at -80°C. 3.6.3. Metagenomic Data We used the genome-resolved metagenomic dataset generated in Chapter 2. Briefly, fecal samples were sequenced and assembled into MAGs using a custom snakemake [172] workflow (MAGmaker, available at https://github.com/CUMoellerLab/sn-mg- pipeline). We used the resulting high-quality MAGs (>90% completeness, <5% contamination) to create a custom genome database of species-genome bins (SGBs) by dereplicating MAGs into 95% average nucleotide identity bins using dRep (v3.4.2) [183]. SGBs were taxonomically profiled using GTDB-Tk (v2.4.0) [141] and we calculated their relative abundance in our samples by mapping all metagenomic reads against our SGB database with Bowtie2 and profiling them with InStrain (v1.8.0) [142]. We normalized the resulting mapped reads count by the respective metagenomic sample’s library size and the respective SGB’s genome size and converted it into a https://github.com/CUMoellerLab/sn-mg-pipeline https://github.com/CUMoellerLab/sn-mg-pipeline 67 percentage. We assessed the genomic divergence in the same SGB between different samples with InStrain Compare (settings: --breadth 0.05 --coverage 0.0025 -- group_length 10000000 --database_mode -ani 0.95). 3.6.5. Statistical Analyses All data analyses were conducted in R (v4.2.2). Data are presented as mean (M) and standard deviation (SD). Throughout the analyses, a p-value < 0.05 was considered statistically significant. For the genomic divergence analyses we only included control mice (i.e., not exposed to predator odor). All plots were created with ggplot2 (v3.4.1) [83]. All figure panels were assembled using Inkscape 1.2. 68 APPENDIX 1.1. Supplemental Results To investigate the effect of sampling bias on the detection of significant effects of Mup deletion on the microbiota in males but not in females, we subsampled our WT males by alternatively removing one male from the analyzes and testing for differences in microbiota beta and alpha diversity and differential abundance at both taxonomic and functional (COG) profiles. PERMANOVA analyses testing for differences in species composition in the gut microbiota of WT and KO males revealed that significance was maintained in 3/4 cases based on Jaccard dissimilarities, and in 1/4 cases using Bray- Curtis dissimilarities (Table S1.7). In terms of COG-function composition, significance was maintained in 2/4 subsampling analyses based on Bray-Curtis dissimilarities but not maintained for analyses based on Jaccard dissimilarities (Table S1.7). Significant differences in microbial family Shannon diversity were observed for 1/4 cases (Table S1.8), but not for alpha diversity measures based on COG functions (Table S1.8). Importantly, subsampling had no qualitative effect on the detection of differentially abundant taxa or functions in males. The significant effects of Mup deletion in males observed in these subsampling analyses—particularly the male-specific differential taxon and COG-function results, which were completely robust to subsampling—lend further support to our conclusions that Mup deletion more strongly affected the microbiota of male mice than female mice. 69 1.2. Supplemental Figures Figure S1.1 Mup genotype birth ratio. Bar plot shows the total percentage of male (top bar) and female (bottom bar) wildtype (blue), heterozygote (red), and knockout (yellow) pups born in the six study litters. 70 Figure S1.2. Mup deletion significantly changes the gut microbial taxonomic composition of mature males. Principal coordinates analyses (PCoA) show the ordinated Jaccard and Bray-Curtis dissimilarities in Species, Genus, and Family composition in the fecal metagenome of sexually mature mice. The ordinated points are faceted by sex and colored by genotype, showing the taxonomic profiles of WT (blue) and KO (yellow) male (left column) and female (right column) mice. The percentage of variation in the taxonomic dissimilarity matrix explained by the first two PCo axes is enclosed in parenthesis. 71 Figure S1.3. Mup deletion significantly changes the gut microbial functional composition of mature males. Principal coordinates analyses (PCoA) show the ordinated Jaccard and Bray-Curtis dissimilarities in COG Functions composition in the fecal metagenome of sexually mature mice. The ordinated points are faceted by sex and colored by genotype, showing the functional profiles of WT (blue) and KO (yellow) male (left column) and female (right column) mice. The percentage of variation in the taxonomic dissimilarity matrix explained by the first two PCo axes is enclosed in parenthesis. 72 Figure S1.4. Mup deletion significantly reduces microbial family diversity in mature males. Box plots show the Shannon Diversity (top row), Pielou’s Evenness (middle row), and Observed Richness (bottom row) in microbial species (left column), genus (middle column), and families (right column) in the gut microbiota of mature males (left sub-column) and females (right sub-column). The linear mixed-effects model analyses (center top) indicate whether there is a significant difference in diversity in the gut microbiota of the WT (blue) and KO (yellow) mice (* = p-value < 0.05; ns = p-value > 0.05). 73 Figure S1.5. Mup deletion significantly reduces microbial functional diversity in mature males. Box plots show the Shannon Diversity (left column), Pielou’s Evenness (middle column), and Observed Richness (right column) in microbial COG Functions in the gut microbiota of mature males (left sub-column) and females (right sub-column). The linear mixed-effects model analyses (center top) indicate whether there is a significant difference in diversity in the gut microbiota of the WT (blue) and KO (yellow) mice (* = p-value < 0.05; ns = p-value > 0.05). 74 Figure S1.6. Mup deletion significantly shifts the abundance of various microbial taxa. Volcano plots show the log2-transformed fold change (LFC) in the abundance of genus (top row) and families (bottom row) in the gut microbiota of mature male (left column) and female (right column) mice. ANCOM-BC2 analyses identified taxa (points) that were significantly more abundant in WT (blue) or KO mice (yellow). Red lines mark the significance threshold (Holm–Bonferroni–adjusted p-value < 0.001). The y-axis indicates the -log10 transformation of the non-adjusted p-value. 75 1.3. Supplemental Tables Table S1.1. Effect of host sex on microbial taxonomic and functional composition (p- value). WT KO Rank Dissimilarity PERMANOVA PERMDISP PERMANOVA PERMDISP Species Jaccard 0.030 0.324 0.057 0.900 Bray-Curtis 0.061 0.284 0.025 0.423 Genus Jaccard 0.019 0.291 0.014 0.840 Bray-Curtis 0.087 0.282 0.007 0.385 Family Jaccard 0.062 0.675 0.031 0.557 Bray-Curtis 0.035 0.806 0.047 0.441 COG Function Jaccard 0.089 0.282 0.009 0.969 Bray-Curtis 0.050 0.188 0.057 0.090 Table S1.2. Effect of Mup genotype on microbial taxonomic and functional composition (p-value). Male Female Rank Dissimilarity PERMANOVA PERMDISP PERMANOVA PERMDISP Species Jaccard 0.037 0.273 0.154 0.739 Bray-Curtis 0.019 0.188 0.158 0.398 Genus Jaccard 0.025 0.175 0.171 0.935 Bray-Curtis 0.009 0.333 0.146 0.397 Family Jaccard 0.197 0.174 0.191 0.947 Bray-Curtis 0.061 0.126 0.404 0.169 COG Function Jaccard 0.021 0.046 0.116 0.633 Bray-Curtis 0.012 0.080 0.481 0.200 Table S1.3. Microbial taxonomic and functional profiles correspondence with Procrustes (p-value). Rank Dissimilarity Male Female Species + COG Jaccard 0.002 0.953 Bray-Curtis 0.001 0.230 Genus + COG Jaccard 0.001 0.943 Bray-Curtis 0.001 0.221 Family + COG Jaccard 0.001 0.866 Bray-Curtis 0.001 0.920 76 Table S1.4. Effect of Mup genotype on microbial taxonomic and functional diversity (p-value). Male Female Rank Metric p-value Estimate p-value Estimate Species Shannon 0.208 0.130 0.980 0.007 Richness 0.320 8.534 0.844 -4.424 Evenness 0.330 0.016 0.609 0.018 Genus Shannon 0.371 0.092 0.895 0.036 Richness 0.356 3.495 0.933 0.745 Evenness 0.428 0.019 0.693 0.017 Family Shannon 0.041 0.242 0.537 0.164 Richness 0.481 -1.390 0.968 -0.093 Evenness 0.041 0.078 0.455 0.052 COG Function Shannon 0.050 0.041 0.484 -0.032 Richness 0.594 10.490 0.476 -41.561 Evenness 0.314 0.002 0.642 -0.001 Table S1.5. Microbial taxa and functions showing differential abundance in WT vs. KO genotypes* Rank Sex Taxa / COG Function p-value LFC Group Species Male SGB43260 1.078E-05 2.595 WT Female SGB41239 4.657E-03 -2.784 KO Genus Male GGB30296 6.324E-06 2.584 WT Female GGB28621 4.286E-03 -2.781 KO COG Function Male Na+/pantothenate symporter 2.874E-05 2.796 WT Male Uncharacterized protein, possibly involved in motility 1.129E-03 1.667 WT Male Predicted hydrocarbon binding protein (contains V4R domain) 1.042E-02 1.434 WT Male L-asparaginase II 1.534E-08 1.427 WT Male Trans-aconitate methyltransferase 2.487E-02 1.427 WT Male Cu/Zn superoxide dismutase 1.102E-04 1.390 WT Male V8-like Glu-specific endopeptidase 1.475E-04 1.385 WT Male Type III secretory pathway, component EscU 2.440E-09 1.308 WT Male Fucose 4-O-acetylase and related acetyltransferases 4.605E-06 1.201 WT Male Cephalosporin hydroxylase 5.297E-06 1.104 WT Male Uncharacterized protein required for formate dehydrogenase 1.398E-05 1.101 WT 77 activity Male Sugar diacid utilization regulator 3.722E-02 1.095 WT Male Sulfite oxidase and related enzymes 1.690E-02 0.989 WT Male Precorrin-2 methylase 3.460E-03 0.850 WT Male Distinct helicase family with a unique C-terminal domain including a metal-binding cysteine cluster 1.379E-03 0.833 WT Male Dissimilatory sulfite reductase (desulfoviridin), alpha and beta subunits 3.145E-02 0.788 WT Male Uncharacterized protein conserved in cyanobacteria 3.573E-04 0.725 WT Male Predicted transcriptional regulators containing the CopG/Arc/MetJ DNA-binding domain 1.039E-04 -0.819 KO Female Glycosylphosphatidylinositol transamidase (GPIT), subunit GPI8 3.456E-03 2.142 WT Female Uroporphyrinogen-III synthase 7.652E-03 -1.781 KO Female Arginine kinase 2.754E-03 -1.915 KO * Highly significant results are bolded (Holm–Bonferroni adjusted p-value < 0.001). Table S1.6. Functional enrichment analyses with a hypergeometric test (p-value). Male Female COG Category WT KO WT KO Cellular processes and Signaling 0.545 1.000 0.205 1.000 Information storage and Processing 1.000 0.170 1.000 1.000 Metabolism 0.425 1.000 1.000 0.189 Poorly characterized 0.251 1.000 1.000 1.000 78 Table S1.7. Power analysis of taxonomic and functional beta diversity results (p- value). Rank Dissimilarity w/o 219 w/o 224 w/o 256 w/o 257 Species Jaccard 0.014 0.039 0.058 0.041 Bray-Curtis 0.119 0.069 0.153 0.046 Genus Jaccard 0.052 0.549 0.118 0.097 Bray-Curtis 0.017 0.097 0.077 0.029 Family Jaccard 0.320 0.138 0.100 0.431 Bray-Curtis 0.084 0.126 0.053 0.175 COG Function Jaccard 0.051 0.089 0.108 0.171 Bray-Curtis 0.032 0.018 0.052 0.120 Table S1.8. Power analysis of taxonomic and functional alpha diversity results (p- value). Rank Metric w/o 219 w/o 224 w/o 256 w/o 257 Species Shannon 0.209 0.806 0.567 0.565 Richness 0.613 0.053 0.685 0.677 Evenness 0.259 0.102 0.024 0.034 Genus Shannon 0.331 0.567 0.859 0.868 Richness 0.795 0.050 0.522 0.516 Evenness 0.252 0.138 0.025 0.027 Family Shannon 0.034 0.184 0.077 0.117 Richness 0.185 0.084 0.629 0.494 Evenness 0.145 0.229 0.095 0.133 COG Function Shannon 0.087 0.057 0.102 0.152 Richness 0.373 0.559 0.558 0.546 Evenness 0.802 0.141 0.303 0.399 79 2.1. Supplemental Figures Figure S2.1. Pair-housed mice exposed to predator odor displayed increased sociability. Box plots show the amount of time that male (triangles) and female (squares) mice of different treatment groups spent interacting with a social stimulus (a stranger mouse) vs. a non-social stimulus (an empty cup) in the three-chamber test (3CT). Differences between the social and non-social interaction time within each treatment group were tested with a paired Wilcoxon test. Significant results (p-value < 0.05) are shown in bold. 80 Figure S2.2. Predator-odor exposure altered VAT gene expression. Principal coordinate analysis (PCoA) shows the first two axes of the ordinated Euclidean distance matrix of the VAT transcriptome at the end of the experiment (D33). Points represent the transcriptome of male (triangles) and female (squares) mice, colored by treatment group: blue, Pair H2O; yellow, Pair TMT; pink, Single H2O; orange, Single TMT. A grey line connects pair-housed cage-mates. The percent variation explained by each axis is enclosed in parentheses. 81 Figure S2.3. Predator odor caused a larger mean fold-change in gene expression than did social isolation. Box plot shows the absolute log2(fold-change) in gene expression of DEGs in the VAT of pair-housed mice exposed to TMT (yellow) and single-housed mice exposed to H2O (pink), when compared to unstressed controls (Pair H2O). The difference between the groups was tested with a Wilcoxon test, and the resulting p-value shown on top of the plot. 82 Figure S2.4. Social isolation increases SGB turnover. Box plot shows the intra- individual SGB Jaccard dissimilarity of male (triangles) and female (squares) mice between the beginning (D0) and end (D30) of the experiment. A linear mixed-effects model (LMM) accounting for sex, litter and cage effects showed a significant difference between pair and single-housed mice (p-value shown on top). 83 2.2. Supplemental Tables Table S2.1. Results from linear mixed-effects model (LMM) showing effects of sex, predator odor (TMT), social isolation (Housing), or their interaction on mouse behavior. Significant differences (p-value < 0.05) are in bold. Behavior Factor Estimate SE DF t-value p-value Center Occupancy Sex 0.008 0.027 40.682 0.298 0.767 Housing -0.084 0.041 39.285 -2.039 0.048 TMT -0.093 0.038 26.584 -2.426 0.022 Housing:TMT 0.105 0.057 41.944 1.822 0.076 Grooming Duration Sex 23.881 11.801 35.951 2.024 0.051 Housing -44.327 20.299 41.979 -2.184 0.035 TMT -26.043 20.615 41.058 -1.263 0.214 Housing:TMT 30.741 26.866 40.768 1.144 0.259 Social Preference Sex -0.105 0.126 40.393 -0.829 0.412 Housing 0.084 0.194 39.010 0.432 0.668 TMT 0.272 0.182 26.259 1.492 0.148 Housing:TMT -0.598 0.270 41.945 -2.212 0.032 84 Table S2.2. Results from pairwise LMM showing the differences in behavior between the different stressor treatment combinations. Significant differences (p-value < 0.05) are in bold. Behavior Contrast Estimate SE DF p-value Center Occupancy Pair H2O - Pair TMT 0.093 0.038 2.426 0.015 Pair H2O - Single H2O 0.084 0.041 2.039 0.041 Pair H2O - Single TMT 0.072 0.039 1.831 0.067 Pair TMT - Single H2O -0.009 0.044 -0.202 0.840 Pair TMT - Single TMT -0.021 0.042 -0.502 0.616 Single H2O - Single TMT -0.012 0.044 -0.274 0.784 Grooming Duration Pair H2O - Pair TMT 26.043 20.615 1.263 0.206 Pair H2O - Single H2O 44.327 20.299 2.184 0.029 Pair H2O - Single TMT 39.629 19.204 2.064 0.039 Pair TMT - Single H2O 18.284 21.045 0.869 0.385 Pair TMT - Single TMT 13.586 19.098 0.711 0.477 Single H2O - Single TMT -4.698 18.213 -0.258 0.796 Social Preference Pair H2O - Pair TMT -0.272 0.182 -1.492 0.136 Pair H2O - Single H2O -0.084 0.194 -0.432 0.666 Pair H2O - Single TMT 0.243 0.185 1.312 0.190 Pair TMT - Single H2O 0.188 0.210 0.896 0.370 Pair TMT - Single TMT 0.514 0.197 2.615 0.009 Single H2O - Single TMT 0.326 0.205 1.596 0.110 85 Table S2.3. Results from PERMANOVA and PERMDISP analyses showing the effect of predator odor (TMT) and social isolation (Housing) on the Euclidean distances of the visceral adipose tissue (VAT) transcriptome. Significant differences (p-value < 0.05) are in bold. Test Factor DF Sum of Squares R2 F statistic p- value PERMANOVA Sex 1 16444.484 0.036 1.666 0.099 Litter 10 195428.974 0.430 1.980 0.002 Housing 1 16593.089 0.037 1.681 0.097 TMT 1 21563.061 0.047 2.185 0.035 Residual 20 197377.341 0.434 Total 33 454424.543 1.000 PERMDISP Housing 1 145.910 145.910 0.242 0.647 Housing:Residuals 32 19273.247 602.289 TMT 1 264.474 264.474 0.498 0.505 TMT:Residuals 32 16998.042 531.189 86 Table S2.4. Significant results (FDR p-value < 0,05) from the biological pathway enrichment analyses of differentially expressed genes (DEGs) in the VAT of TMT- exposed (Pair TMT) and single-housed mice (Single H2O) when compared to unstressed controls (Pair H2O). The gene ontology (GO) containing genes involved in antimicrobial humoral immune response mediated by antimicrobial peptides (AMPs) is in bold. Comparison GO ID Description GeneRatio BgRatio p-value FDR p- value Pair H2O - Pair TMT GO:0031016 pancreas development 7/127 75/17475 1.194E- 06 0.002 GO:0031638 zymogen activation 6/127 66/17475 8.321E- 06 0.007 GO:0061844 antimicrobial humoral immune response mediated by antimicrobial peptide 6/127 75/17475 1.748E- 05 0.007 GO:0031018 endocrine pancreas development 5/127 45/17475 1.813E- 05 0.007 GO:0016485 protein processing 9/127 249/17475 8.619E- 05 0.028 GO:0043588 skin development 9/127 266/17475 1.422E- 04 0.036 GO:0007586 digestion 6/127 113/17475 1.752E- 04 0.036 GO:0035270 endocrine system development 6/127 113/17475 1.752E- 04 0.036 GO:0019730 antimicrobial humoral response 6/127 116/17475 2.022E- 04 0.037 Pair H2O - Single H2O GO:0007586 digestion 7/75 113/17475 5.414E- 07 0.001 GO:0007631 feeding behavior 6/75 109/17475 7.279E- 06 0.004 GO:0031016 pancreas development 5/75 75/17475 1.737E- 05 0.004 GO:0061844 antimicrobial humoral immune response 5/75 75/17475 1.737E- 05 0.004 87 mediated by antimicrobial peptide GO:0019730 antimicrobial humoral response 5/75 116/17475 1.408E- 04 0.029 GO:0031638 zymogen activation 4/75 66/17475 1.844E- 04 0.031 88 Table S2.5. Results from random forest models testing the predictive power of SGB abundances at D22 and VAT transcriptome on host phenotypes. Significant results (p- value < 0.05) are in bold. Predictor Phenotype Variable Permutation test R2 p-value Gut microbiota Behavior Center occupancy -0.545 0.623 Gut microbiota Behavior Grooming duration 0.021 0.016 Gut microbiota Behavior Social preference 0.102 0.001 Gut microbiota VAT transcriptome PC1 0.008 0.033 Gut microbiota VAT transcriptome PC2 -0.143 0.120 Gut microbiota VAT transcriptome PC3 -0.671 0.653 Gut microbiota VAT transcriptome PC4 -0.387 0.109 VAT transcriptome Behavior Center occupancy -0.899 0.835 VAT transcriptome Behavior Grooming duration -0.467 0.454 VAT transcriptome Behavior Social preference -0.902 0.852 89 Table S2.6. Summary results of predictive power (Gini Importance) of SGBs that were persistently associated with TMT exposure (DA at both D22 and D30). SGBs that ranked in the top half most important features are in bold. Phenotype Variable SGB ID Gini Importance Rank Behavior Grooming Duration SGB107 2.74E-03 60 SGB158 7.97E-04 83 SGB051 6.47E-04 89 SGB074 6.12E-04 90 SGB108 3.58E-04 103 SGB002 1.72E-05 148 SGB105 0.00E+00 172 Social Preference SGB002 1.80E-02 20 SGB105 7.17E-03 39 SGB107 3.04E-03 63 SGB158 2.33E-03 71 SGB074 2.77E-04 116 SGB108 0.00E+00 167 SGB051 0.00E+00 168 VAT PC1 SGB105 5.96E-03 34 SGB158 6.60E-04 77 SGB107 5.91E-04 79 SGB002 1.32E-04 101 SGB074 1.11E-04 105 SGB108 3.32E-05 118 SGB051 0.00E+00 169 90 REFERENCES 1. Chevalier, C., et al., Gut Microbiota Orchestrates Energy Homeostasis during Cold. Cell, 2015. 163(6): p. 1360-74. 2. Bäckhed, F., et al., The gut microbiota as an environmental factor that regulates fat storage. Proceedings of the national academy of sciences, 2004. 101(44): p. 15718-15723. 3. Turnbaugh, P.J., et al., Diet-induced obesity is linked to marked but reversible alterations in the mouse distal gut microbiome. Cell host & microbe, 2008. 3(4): p. 213-223. 4. Tremaroli, V. and F. Bäckhed, Functional interactions between the gut microbiota and host metabolism. Nature, 2012. 489(7415): p. 242-249. 5. Moreno-Navarrete, J.M. and J.M. Fernandez-Real, The gut microbiota modulates both browning of white adipose tissue and the activity of brown adipose tissue. Reviews in Endocrine and Metabolic Disorders, 2019. 20: p. 387-397. 6. Sarkar, A., et al., The Microbiome in Psychology and Cognitive Neuroscience. Trends Cogn Sci, 2018. 22(7): p. 611-636. 7. Sarkar, A., et al., The role of the microbiome in the neurobiology of social behaviour. Biol Rev Camb Philos Soc, 2020. 95(5): p. 1131-1166. 8. Diaz Heijtz, R., et al., Normal gut microbiota modulates brain development and behavior. Proc Natl Acad Sci U S A, 2011. 108(7): p. 3047-52. 9. Foster, K.R., et al., The evolution of the host microbiome as an ecosystem on a leash. Nature, 2017. 548(7665): p. 43-51. 10. Rehman, A., et al., Nod2 is essential for temporal development of intestinal microbial communities. Gut, 2011. 60(10): p. 1354-1362. 11. Vijay-Kumar, M., et al., Metabolic syndrome and altered gut microbiota in mice lacking Toll-like receptor 5. Science, 2010. 328(5975): p. 228-31. 12. Kwon, O., et al., Altered Gut Microbiota Composition in Rag1-deficient Mice Contributes to Modulating Homeostasis of Hematopoietic Stem and Progenitor Cells. Immune Netw, 2015. 15(5): p. 252-9. 91 13. Galvez, E.J.C., et al., Shaping of Intestinal Microbiota in Nlrp6- and Rag2- Deficient Mice Depends on Community Structure. Cell Rep, 2017. 21(13): p. 3914-3926. 14. Sprockett, D.D., et al., Home-site advantage for host species–specific gut microbiota. Science Advances, 2023. 9(19): p. eadf5499. 15. He, Q., et al., Lactobacillus casei Zhang exerts anti-obesity effect to obese glut1 and gut-specific-glut1 knockout mice via gut microbiota modulation mediated different metagenomic pathways. European Journal of Nutrition, 2022. 61(4): p. 2003-2014. 16. Neugebauer, K.A., et al., Baat Gene Knockout Alters Post-Natal Development, the Gut Microbiome, and Reveals Unusual Bile Acids in Mice. Journal of Lipid Research, 2022. 63(12). 17. Niska-Blakie, J., et al., Knockout of the non-essential gene SUGCT creates diet-linked, age-related microbiome disbalance with a diabetes-like metabolic syndrome phenotype. Cellular and Molecular Life Sciences, 2020. 77: p. 3423- 3439. 18. Chamero, P., et al., Identification of protein pheromones that promote aggressive behaviour. Nature, 2007. 450(7171): p. 899-902. 19. Nevison, C., et al., The ownership signature in mouse scent marks is involatile. Proceedings of the Royal Society of London. Series B: Biological Sciences, 2003. 270(1527): p. 1957-1963. 20. Timm, D.E., et al., Structural basis of pheromone binding to mouse major urinary protein (MUP‐I). Protein Science, 2001. 10(5): p. 997-1004. 21. Charkoftaki, G., et al., Update on the human and mouse lipocalin (LCN) gene family, including evidence the mouse Mup cluster is result of an “evolutionary bloom”. Human genomics, 2019. 13(1): p. 1-14. 22. Cheetham, S.A., et al., The genetic basis of individual-recognition signals in the mouse. Current Biology, 2007. 17(20): p. 1771-1777. 23. Sheehan, M.J., et al., Selection on Coding and Regulatory Variation Maintains Individuality in Major Urinary Protein Scent Marks in Wild Mice. PLoS Genet, 2016. 12(3): p. e1005891. 24. Hurst, J.L., et al., Individual recognition in mice mediated by major urinary proteins. Nature, 2001. 414(6864): p. 631-634. 25. Logan, D.W., T.F. Marton, and L. Stowers, Species specificity in major urinary proteins by parallel evolution. PloS one, 2008. 3(9): p. e3280. 92 26. Penn, D. and W.K. Potts, Chemical signals and parasite-mediated sexual selection. Trends in Ecology & Evolution, 1998. 13(10): p. 391-396. 27. Schellinck, H.M., A.M. West, and R.E. Brown, Rats can discriminate between the urine odors of genetically identical mice maintained on different diets. Physiology & behavior, 1992. 51(5): p. 1079-1082. 28. Green, J.P., et al., The Genetic Basis of Kin Recognition in a Cooperatively Breeding Mammal. Curr Biol, 2015. 25(20): p. 2631-41. 29. Hurst, J.L., Female recognition and assessment of males through scent. Behavioural brain research, 2009. 200(2): p. 295-303. 30. Ramm, S.A., S.A. Cheetham, and J.L. Hurst, Encoding choosiness: female attraction requires prior physical contact with individual male scents in mice. Proceedings of the Royal Society B: Biological Sciences, 2008. 275(1644): p. 1727-1735. 31. Thom, M.D., et al., The direct assessment of genetic heterozygosity through scent in the mouse. Curr Biol, 2008. 18(8): p. 619-23. 32. Hurst, J.L., The functions of urine marking in a free-living population of house mice, Mus domesticus Rutty. Animal Behaviour, 1987. 35(5): p. 1433-1442. 33. Thonhauser, K.E., et al., Scent marking increases male reproductive success in wild house mice. Animal Behaviour, 2013. 86(5): p. 1013-1021. 34. Beynon, R.J. and J.L. Hurst, Urinary proteins and the modulation of chemical scents in mice and rats. Peptides, 2004. 25(9): p. 1553-63. 35. Penn, D.J., S.M. Zala, and K.C. Luzynski, Regulation of Sexually Dimorphic Expression of Major Urinary Proteins. Front Physiol, 2022. 13: p. 822073. 36. Sheehan, M.J., P. Campbell, and C.H. Miller, Evolutionary patterns of major urinary protein scent signals in house mice and relatives. Mol Ecol, 2019. 28(15): p. 3587-3601. 37. Payne, C.E., et al., Heterogeneity of major urinary proteins in house mice: population and sex differences. Chemical Signals in Vertebrates 9, 2001: p. 233-240. 38. Thoss, M., et al., Major urinary protein (MUP) profiles show dynamic changes rather than individual “barcode” signatures. Frontiers in ecology and evolution, 2015. 3: p. 71. 39. Thoß, M., et al., Regulation of volatile and non-volatile pheromone attractants depends upon male social status. Scientific Reports, 2019. 9(1): p. 489. 93 40. Luzynski, K.C., et al., Pheromones that correlate with reproductive success in competitive conditions. Scientific Reports, 2021. 11(1): p. 21970. 41. Hui, X., et al., Major urinary protein-1 increases energy expenditure and improves glucose intolerance through enhancing mitochondrial function in skeletal muscle of diabetic mice. J Biol Chem, 2009. 284(21): p. 14050-7. 42. Giller, K., et al., Major urinary protein 5, a scent communication protein, is regulated by dietary restriction and subsequent re-feeding in mice. Proceedings of the Royal Society B: Biological Sciences, 2013. 280(1757): p. 20130101. 43. Mitchell, S.E., et al., The effects of graded levels of calorie restriction: II. Impact of short term calorie and protein restriction on circulating hormone levels, glucose homeostasis and oxidative stress in male C57BL/6 mice. Oncotarget, 2015. 6(27): p. 23213. 44. Zhou, Y., L. Jiang, and L. Rui, Identification of MUP1 as a regulator for glucose and lipid metabolism in mice. Journal of Biological Chemistry, 2009. 284(17): p. 11152-11159. 45. Greve, S., et al., The major urinary protein gene cluster knockout mouse as a novel model for translational metabolism research. Sci Rep, 2022. 12(1): p. 13161. 46. Kreznar, J.H., et al., Host genotype and gut microbiome modulate insulin secretion and diet-induced metabolic phenotypes. Cell reports, 2017. 18(7): p. 1739-1750. 47. Holmes, E., et al., Understanding the role of gut microbiome–host metabolic signal disruption in health and disease. Trends in microbiology, 2011. 19(7): p. 349-359. 48. Kawaji, H., et al., The FANTOM5 collection, a data series underpinning mammalian transcriptome atlases in diverse cell types. Scientific data, 2017. 4(1): p. 1-3. 49. Geiger, T., et al., Initial quantitative proteomic map of 28 mouse tissues using the SILAC mouse. Molecular & Cellular Proteomics, 2013. 12(6): p. 1709- 1722. 50. Reizer, J., A. Reizer, and M. Saier Jr, The Na+/pantothenate symporter (PanF) of Escherichia coli is homologous to the Na+/proline symporter (PutP) of E. coli and the Na+/glucose symporters of mammals. Research in microbiology, 1990. 141(9): p. 1069-1072. 94 51. Hueck, C.J., Type III protein secretion systems in bacterial pathogens of animals and plants. Microbiology and molecular biology reviews, 1998. 62(2): p. 379-433. 52. Zarivach, R., et al., Structural analysis of the essential self-cleaving type III secretion proteins EscU and SpaS. Nature, 2008. 453(7191): p. 124-127. 53. Srikhanta, Y.N., et al., Distinct physiological roles for the two L-asparaginase isozymes of Escherichia coli. Biochemical and biophysical research communications, 2013. 436(3): p. 362-365. 54. Yang, K., et al., Structural basis for substrate binding and the catalytic mechanism of type III pantothenate kinase. Biochemistry, 2008. 47(5): p. 1369-1380. 55. Campbell, J.H., et al., Host genetic and environmental effects on mouse intestinal microbiota. The ISME journal, 2012. 6(11): p. 2033-2044. 56. Hildebrand, F., et al., Inflammation-associated enterotypes, host genotype, cage and inter-individual effects drive gut microbiota variation in common laboratory mice. Genome biology, 2013. 14(1): p. 1-15. 57. Le Chatelier, E., et al., Richness of human gut microbiome correlates with metabolic markers. Nature, 2013. 500(7464): p. 541-546. 58. Turnbaugh, P.J., et al., A core gut microbiome in obese and lean twins. nature, 2009. 457(7228): p. 480-484. 59. Menni, C., et al., Gut microbiome diversity and high-fibre intake are related to lower long-term weight gain. International journal of obesity, 2017. 41(7): p. 1099-1105. 60. Ziętak, M., et al., Altered microbiota contributes to reduced diet-induced obesity upon cold exposure. Cell metabolism, 2016. 23(6): p. 1216-1223. 61. Feng, L., et al., Gut microbiota-mediated improvement of metabolic disorders by Qingzhuan tea in high fat diet-fed mice. Journal of Functional Foods, 2021. 78: p. 104366. 62. Guo, J., et al., Gut microbiota and short chain fatty acids partially mediate the beneficial effects of inulin on metabolic disorders in obese ob/ob mice. Journal of Food Biochemistry, 2022. 46(5): p. e14063. 63. Darnaud, M., et al., Enteric delivery of regenerating family member 3 alpha alters the intestinal microbiota and controls inflammation in mice with colitis. Gastroenterology, 2018. 154(4): p. 1009-1023. e14. 95 64. Louis, P., G.L. Hold, and H.J. Flint, The gut microbiota, bacterial metabolites and colorectal cancer. Nature reviews microbiology, 2014. 12(10): p. 661-672. 65. Hamer, H.M., et al., The role of butyrate on colonic function. Alimentary pharmacology & therapeutics, 2008. 27(2): p. 104-119. 66. Webb, M.E., A.G. Smith, and C. Abell, Biosynthesis of pantothenate. Natural product reports, 2004. 21(6): p. 695-721. 67. Magnúsdóttir, S., et al., Systematic genome assessment of B-vitamin biosynthesis suggests co-operation among gut microbes. Frontiers in genetics, 2015. 6: p. 148. 68. Soto-Martin, E.C., et al., Vitamin biosynthesis by human gut butyrate- producing bacteria and cross-feeding in synthetic microbial communities. MBio, 2020. 11(4): p. 10.1128/mbio. 00886-20. 69. Heinken, A., et al., Functional metabolic map of Faecalibacterium prausnitzii, a beneficial human gut microbe. Journal of bacteriology, 2014. 196(18): p. 3289-3302. 70. D'Souza, G.G., et al., Ecology and evolution of metabolic cross-feeding interactions in bacteria. Natural Product Reports, 2018. 35(5): p. 455-488. 71. Weger, B.D., et al., The Mouse Microbiome Is Required for Sex-Specific Diurnal Rhythms of Gene Expression and Metabolism. Cell Metab, 2019. 29(2): p. 362-382 e8. 72. Taketo, M., et al., FVB/N: an inbred mouse strain preferable for transgenic analyses. Proceedings of the National Academy of Sciences, 1991. 88(6): p. 2065-2069. 73. Townsend, D., C.J. Witkop Jr, and J. Mattson, Tyrosinase subcellular distribution and kinetic parameters in wild type and c‐locus mutant C57BL/6J mice. Journal of Experimental Zoology, 1981. 216(1): p. 113-119. 74. Gaio, D., et al., Hackflex: low cost Illumina Nextera Flex sequencing library construction. 2019. 75. Andrews, S., FastQC: a quality control tool for high throughput sequence data. 2010, Babraham Bioinformatics, Babraham Institute, Cambridge, United Kingdom. 76. Martin, M., Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet. journal, 2011. 17(1): p. 10-12. 96 77. Langmead, B. and S.L. Salzberg, Fast gapped-read alignment with Bowtie 2. Nature methods, 2012. 9(4): p. 357-359. 78. Blanco-Míguez, A., et al., Extending and improving metagenomic taxonomic profiling with uncharacterized species using MetaPhlAn 4. Nature Biotechnology, 2023: p. 1-12. 79. Keegan, K.P., E.M. Glass, and F. Meyer, MG-RAST, a metagenomics service for analysis of microbial community structure and function. Microbial environmental genomics (MEG), 2016: p. 207-233. 80. Schwengers, O., et al., Bakta: rapid and standardized annotation of bacterial genomes via alignment-free sequence identification. Microbial genomics, 2021. 7(11): p. 000685. 81. Lahti, L. and S. Shetty, Introduction to the microbiome R package. 2018. 82. McMurdie, P.J. and S. Holmes, phyloseq: an R package for reproducible interactive analysis and graphics of microbiome census data. PloS one, 2013. 8(4): p. e61217. 83. Wickham, H., W. Chang, and M.H. Wickham, Package ‘ggplot2’. Create elegant data visualisations using the grammar of graphics. Version, 2016. 2(1): p. 1-189. 84. Kuznetsova, A., P. Brockhoff, and R. Christensen, Package ‘lmertest’. Version 3.1-0. Computer software]. Retrieved from https://cran. r-project. org, 2019. 85. Anderson, M.J., Permutational multivariate analysis of variance. Department of Statistics, University of Auckland, Auckland, 2005. 26: p. 32-46. 86. Anderson, M.J., K.E. Ellingsen, and B.H. McArdle, Multivariate dispersion as a measure of beta diversity. Ecology letters, 2006. 9(6): p. 683-693. 87. Oksanen, J., et al., Package ‘vegan’. Community ecology package, version, 2013. 2(9): p. 1-295. 88. Lin, H. and S.D. Peddada, Analysis of compositions of microbiomes with bias correction. Nature communications, 2020. 11(1): p. 1-11. 89. Romero, L.M., M.J. Dickens, and N.E. Cyr, The Reactive Scope Model - a new model integrating homeostasis, allostasis, and stress. Horm Behav, 2009. 55(3): p. 375-89. 90. Levine, S. and H. Ursin, What is stress?, in Neurobiology and Neuroendocrinology. 1991, New York: Marcel Dekker. https://cran/ 97 91. Del Giudice, M., et al., What Is Stress? A Systems Perspective. Integr Comp Biol, 2018. 58(6): p. 1019-1032. 92. Du Preez, A., et al., The type of stress matters: repeated injection and permanent social isolation stress in male mice have a differential effect on anxiety- and depressive-like behaviours, and associated biological alterations. Transl Psychiatry, 2020. 10(1): p. 325. 93. Du Preez, A., et al., Do different types of stress differentially alter behavioural and neurobiological outcomes associated with depression in rodent models? A systematic review. Front Neuroendocrinol, 2021. 61: p. 100896. 94. Barnum, C.J., et al., Psychological stress in adolescent and adult mice increases neuroinflammation and attenuates the response to LPS challenge. Journal of Neuroinflammation, 2012. 9: p. 1-15. 95. Liu, X., et al., Effects of group housing on stress induced emotional and neuroendocrine alterations. Brain Res, 2013. 1502: p. 71-80. 96. Pearson-Leary, J., et al., The gut microbiome regulates the increases in depressive-type behaviors and in inflammatory processes in the ventral hippocampus of stress vulnerable rats. Mol Psychiatry, 2020. 25(5): p. 1068- 1079. 97. Davis, D.J., et al., Lactobacillus plantarum attenuates anxiety-related behavior and protects against stress-induced dysbiosis in adult zebrafish. Sci Rep, 2016. 6: p. 33726. 98. Chevalier, G., et al., Effect of gut microbiota on depressive-like behaviors in mice is mediated by the endocannabinoid system. Nat Commun, 2020. 11(1): p. 6363. 99. de Weerth, C., Do bacteria shape our development? Crosstalk between intestinal microbiota and HPA axis. Neurosci Biobehav Rev, 2017. 83: p. 458- 471. 100. Mir, H.D., et al., The gut microbiota metabolite indole increases emotional responses and adrenal medulla activity in chronically stressed male mice. Psychoneuroendocrinology, 2020. 119: p. 104750. 101. Agranyoni, O., et al., Gut microbiota determines the social behavior of mice and induces metabolic and inflammatory changes in their adipose tissue. NPJ Biofilms Microbiomes, 2021. 7(1): p. 28. 102. Werbner, M., et al., Social-Stress-Responsive Microbiota Induces Stimulation of Self-Reactive Effector T Helper Cells. mSystems, 2019. 4(4). 98 103. Weiss, S., Microbiota as mediator and moderator of stress. Bioessays, 2021. 43(1): p. e2000277. 104. Moeller, A.H. and J.G. Sanders, Roles of the gut microbiota in the adaptive evolution of mammalian species. Philos Trans R Soc Lond B Biol Sci, 2020. 375(1808): p. 20190597. 105. Candela, M., et al., Intestinal microbiota is a plastic factor responding to environmental changes. Trends in microbiology, 2012. 20(8): p. 385-391. 106. David, L.A., et al., Host lifestyle affects human microbiota on daily timescales. Genome biology, 2014. 15(7): p. 1-15. 107. David, L.A., et al., Diet rapidly and reproducibly alters the human gut microbiome. Nature, 2014. 505(7484): p. 559-563. 108. Turnbaugh, P.J., et al., The effect of diet on the human gut microbiome: a metagenomic analysis in humanized gnotobiotic mice. Science translational medicine, 2009. 1(6): p. 6ra14-6ra14. 109. Huang, L., et al., Commensal microbe-derived propionic acid mediates juvenile social isolation-induced social deficits and anxiety-like behaviors. Brain Research Bulletin, 2021. 166: p. 161-171. 110. Usui, N., H. Matsuzaki, and S. Shimada, Characterization of Early Life Stress- Affected Gut Microbiota. Brain sciences, 2021. 11(7): p. 913. 111. Dunphy-Doherty, F., et al., Post-weaning social isolation of rats leads to long- term disruption of the gut microbiota-immune-brain axis. Brain, behavior, and immunity, 2018. 68: p. 261-273. 112. Apfelbach, R., et al., The effects of predator odors in mammalian prey species: a review of field and laboratory studies. Neuroscience & Biobehavioral Reviews, 2005. 29(8): p. 1123-1144. 113. Baumbach, J.L., et al., A single exposure to the predator odor 2, 4, 5- trimethylthiazoline causes long-lasting affective behavioral changes in female mice: Modulation by kappa opioid receptor signaling. Pharmacology Biochemistry and Behavior, 2024. 242: p. 173822. 114. Post, R.J., et al., Effects of juvenile exposure to predator odor on adolescent and adult anxiety and pain nociception. Physiology & behavior, 2014. 131: p. 57-61. 115. Hebb, A.L., et al., Brief exposure to predator odor and resultant anxiety enhances mesocorticolimbic activity and enkephalin expression in CD‐1 mice. European Journal of Neuroscience, 2004. 20(9): p. 2415-2429. 99 116. Janitzky, K., et al., Behavioral effects and pattern of brain c-fos mRNA induced by 2, 5-dihydro-2, 4, 5-trimethylthiazoline, a component of fox feces odor in GAD67-GFP knock-in C57BL/6 mice. Behavioural brain research, 2009. 202(2): p. 218-224. 117. Hebb, A.L., et al., Odor-induced variation in anxiety-like behavior in mice is associated with discrete and differential effects on mesocorticolimbic cholecystokinin mRNA expression. Neuropsychopharmacology, 2002. 27(5): p. 744-755. 118. Oh, J.H. and B. Rehermann, Natural versus laboratory world: incorporating wild-derived microbiota into preclinical rodent models. The Journal of Immunology, 2021. 207(7): p. 1703-1709. 119. Bruno, P., T. Schüler, and S.P. Rosshart, Born to be wild: utilizing natural microbiota for reliable biomedical research. Trends in Immunology, 2024. 120. Sheehan, M.J., P. Campbell, and C.H. Miller, Evolutionary patterns of major urinary protein scent signals in house mice and relatives. Molecular ecology, 2019. 28(15): p. 3587-3601. 121. Miller, C.H., et al., Dynamic changes to signal allocation rules in response to variable social environments in house mice. Communications Biology, 2023. 6(1): p. 297. 122. Miller, C.H., et al., Scent mark signal investment predicts fight dynamics in house mice. Proceedings of the Royal Society B, 2023. 290(1993): p. 20222489. 123. Gould, T.D., D.T. Dao, and C.E. Kovacsics, The open field test. Mood and anxiety related phenotypes in mice, 2009: p. 1-20. 124. Hacquemand, R., et al., Comparison between low doses of TMT and cat odor exposure in anxiety-and fear-related behaviors in mice. Behavioural brain research, 2013. 238: p. 227-231. 125. Blanchard, R.J., et al., The characterization and modelling of antipredator defensive behavior. Neuroscience & Biobehavioral Reviews, 1990. 14(4): p. 463-472. 126. Nollet, M., A.M.L. Guisquet, and C. Belzung, Models of depression: unpredictable chronic mild stress in mice. Current protocols in pharmacology, 2013. 61(1): p. 5.65. 1-5.65. 17. 127. Zangrossi Jr, H. and S.E. File, Behavioral consequences in animal tests of anxiety and exploration of exposure to cat odor. Brain research bulletin, 1992. 29(3-4): p. 381-388. 100 128. Rein, B., K. Ma, and Z. Yan, A standardized social preference protocol for measuring social deficits in mouse models of autism. Nat Protoc, 2020. 15(10): p. 3464-3477. 129. Liu, J., et al., Adiponectin is critical in determining susceptibility to depressive behaviors and has antidepressant-like activity. Proc Natl Acad Sci U S A, 2012. 109(30): p. 12248-53. 130. Grant, R.W. and V.D. Dixit, Adipose tissue as an immunological organ. Obesity, 2015. 23(3): p. 512-518. 131. Wu, Y. and Y. Ma, CCL2‐CCR2 signaling axis in obesity and metabolic diseases. Journal of Cellular Physiology, 2024. 239(4): p. e31192. 132. Kelly, J.R., et al., Breaking down the barriers: the gut microbiome, intestinal permeability and stress-related psychiatric disorders. Frontiers in cellular neuroscience, 2015. 9: p. 392. 133. Bertin, B., P. Desreumaux, and L. Dubuquoy, Obesity, visceral fat and Crohn's disease. Current Opinion in Clinical Nutrition & Metabolic Care, 2010. 13(5): p. 574-580. 134. Karrasch, T. and A. Schaeffler, Adipokines and the role of visceral adipose tissue in inflammatory bowel disease. Annals of Gastroenterology: Quarterly Publication of the Hellenic Society of Gastroenterology, 2016. 29(4): p. 424. 135. Batra, A., et al., Mesenteric fat—control site for bacterial translocation in colitis? Mucosal Immunology, 2012. 5(5): p. 580-591. 136. Zhang, L.-j., et al., Dermal adipocytes protect against invasive Staphylococcus aureus skin infection. Science, 2015. 347(6217): p. 67-71. 137. Alcorn, J.F. and J.K. Kolls, Killer fat. Science, 2015. 347(6217): p. 26-27. 138. Guo, D.-H., et al., Visceral adipose NLRP3 impairs cognition in obesity via IL- 1R1 on CX3CR1+ cells. The Journal of clinical investigation, 2020. 130(4): p. 1961-1976. 139. Sanders, J.G., et al., Widespread extinctions of co-diversified primate gut bacterial symbionts from humans. Nat Microbiol, 2023. 8(6): p. 1039-1050. 140. Parks, D.H., et al., GTDB: an ongoing census of bacterial and archaeal diversity through a phylogenetically consistent, rank normalized and complete genome-based taxonomy. Nucleic acids research, 2022. 50(D1): p. D785- D794. 101 141. Chaumeil, P.-A., et al., GTDB-Tk: a toolkit to classify genomes with the Genome Taxonomy Database. 2020, Oxford University Press. 142. Olm, M.R., et al., inStrain profiles population microdiversity from metagenomic data and sensitively detects shared microbial strains. Nat Biotechnol, 2021. 143. Patel, K.V., et al., Impact of acute stress on the canine gut microbiota. Scientific Reports, 2024. 14(1): p. 18897. 144. Rodiño-Janeiro, B.K., et al., Acute stress triggers sex-dependent rapid alterations in the human small intestine microbiota composition. Frontiers in Microbiology, 2025. 15: p. 1441126. 145. Bowen, M.T., et al., Aggregation in quads but not pairs of rats exposed to cat odor or bright light. Behavioural processes, 2012. 90(3): p. 331-336. 146. Sandi, C. and J. Haller, Stress and the social brain: behavioural effects and neurobiological mechanisms. Nature reviews neuroscience, 2015. 16(5): p. 290-304. 147. Li, A.-l., et al., Effect of 2′-fucosyllactose supplementation on intestinal flora in mice with intestinal inflammatory diseases. International Dairy Journal, 2020. 110: p. 104797. 148. Zhao, R. and G.X. Shen, Impact of anthocyanin component and metabolite of Saskatoon berry on gut microbiome and relationship with fecal short chain fatty acids in diet-induced insulin resistant mice. The Journal of Nutritional Biochemistry, 2023. 111: p. 109201. 149. Zhan, F., et al., Cucurbitacin E Alleviates Colonic Barrier Function Impairment and Inflammation Response and Improves Microbial Composition on Experimental Colitis Models. Journal of Inflammation Research, 2024: p. 2745-2756. 150. Lee, K.S., et al., An automated Raman-based platform for the sorting of live cells by functional properties. Nature microbiology, 2019. 4(6): p. 1035-1048. 151. Volk, J.K., et al., The Nlrp6 inflammasome is not required for baseline colonic inner mucus layer formation or function. Journal of Experimental Medicine, 2019. 216(11): p. 2602-2618. 152. van der Hee, B. and J.M. Wells, Microbial regulation of host physiology by short-chain fatty acids. Trends in microbiology, 2021. 29(8): p. 700-712. 153. Zhu, Y., et al., Exploration of the muribaculaceae family in the gut microbiota: diversity, metabolism, and function. Nutrients, 2024. 16(16): p. 2660. 102 154. Agirman, G., K.B. Yu, and E.Y. Hsiao, Signaling inflammation across the gut- brain axis. Science, 2021. 374(6571): p. 1087-1092. 155. Fung, T.C., The microbiota-immune axis as a central mediator of gut-brain communication. Neurobiology of disease, 2020. 136: p. 104714. 156. Puricelli, C., et al., The gut-brain-immune axis in autism spectrum disorders: a state-of-art report. Frontiers in Psychiatry, 2022. 12: p. 755171. 157. Crumeyrolle-Arias, M., et al., Absence of the gut microbiota enhances anxiety- like behavior and neuroendocrine response to acute stress in rats. Psychoneuroendocrinology, 2014. 42: p. 207-17. 158. Lyte, J.M., et al., Gut-brain axis serotonergic responses to acute stress exposure are microbiome-dependent. Neurogastroenterol Motil, 2020. 32(11): p. e13881. 159. Rosell-Cardona, C., et al., Acute stress enhances synaptic plasticity in male mice via a microbiota-dependent mechanism. Neuropharmacology, 2025. 273: p. 110434. 160. Vagnerová, K., et al., Interactions between gut microbiota and acute restraint stress in peripheral structures of the hypothalamic–pituitary–adrenal axis and the intestine of male mice. Frontiers in immunology, 2019. 10: p. 2655. 161. Moeller, A.H., et al., Transmission modes of the mammalian gut microbiota. Science, 2018. 362(6413): p. 453-457. 162. Vogt, C.C., et al., Female behavior drives the formation of distinct social structures in C57BL/6J versus wild-derived outbred mice in field enclosures. BMC biology, 2024. 22(1): p. 35. 163. Tuttle, A.H., et al., Social propinquity in rodents as measured by tube cooccupancy differs between inbred and outbred genotypes. Proceedings of the National Academy of Sciences, 2017. 114(21): p. 5515-5520. 164. Smith, J., J.L. Hurst, and C. Barnard, Comparing behaviour in wild and laboratory strains of the house mouse: levels of comparison and functional inference. Behavioural processes, 1994. 32(1): p. 79-86. 165. Moy, S., et al., Sociability and preference for social novelty in five inbred strains: an approach to assess autistic‐like behavior in mice. Genes, Brain and Behavior, 2004. 3(5): p. 287-302. 166. Blanchard, R.J., et al., Defensive behaviors in wild and laboratory (Swiss) mice: the mouse defense test battery. Physiology & behavior, 1998. 65(2): p. 201-209. 103 167. Dumont, B.L., et al., Into the Wild: A novel wild-derived inbred strain resource expands the genomic and phenotypic diversity of laboratory mouse models. PLoS genetics, 2024. 20(4): p. e1011228. 168. Rodriguez, A., et al., ToxTrac: a fast and robust software for tracking organisms. Methods in Ecology and Evolution, 2018. 9(3): p. 460-464. 169. Nollet, M., Models of Depression: Unpredictable Chronic Mild Stress in Mice. Curr Protoc, 2021. 1(8): p. e208. 170. Kalueff, A.V. and P. Tuohimaa, Grooming analysis algorithm for neurobehavioural stress research. Brain Research Protocols, 2004. 13(3): p. 151-158. 171. Dobin, A., et al., STAR: ultrafast universal RNA-seq aligner. Bioinformatics, 2013. 29(1): p. 15-21. 172. Mölder, F., et al., Sustainable data analysis with Snakemake. F1000Research, 2021. 10. 173. Li, D., et al., MEGAHIT: an ultra-fast single-node solution for large and complex metagenomics assembly via succinct de Bruijn graph. Bioinformatics, 2015. 31(10): p. 1674-1676. 174. Gurevich, A., et al., QUAST: quality assessment tool for genome assemblies. Bioinformatics, 2013. 29(8): p. 1072-1075. 175. Brown, C.T. and L. Irber, sourmash: a library for MinHash sketching of DNA. Journal of open source software, 2016. 1(5): p. 27. 176. Li, H., Minimap2: pairwise alignment for nucleotide sequences. Bioinformatics, 2018. 34(18): p. 3094-3100. 177. Alneberg, J., et al., Binning metagenomic contigs by coverage and composition. Nat Methods, 2014. 11(11): p. 1144-6. 178. Kang, D.D., et al., MetaBAT 2: an adaptive binning algorithm for robust and efficient genome reconstruction from metagenome assemblies. PeerJ, 2019. 7: p. e7359. 179. Wu, Y.W., B.A. Simmons, and S.W. Singer, MaxBin 2.0: an automated binning algorithm to recover genomes from multiple metagenomic datasets. Bioinformatics, 2016. 32(4): p. 605-7. 180. Sieber, C.M., et al., Recovery of genomes from metagenomes via a dereplication, aggregation and scoring strategy. Nature microbiology, 2018. 3(7): p. 836-843. 104 181. Parks, D.H., et al., CheckM: assessing the quality of microbial genomes recovered from isolates, single cells, and metagenomes. Genome research, 2015. 25(7): p. 1043-1055. 182. Orakov, A., et al., GUNC: detection of chimerism and contamination in prokaryotic genomes. Genome Biol, 2021. 22(1): p. 178. 183. Olm, M.R., et al., dRep: a tool for fast and accurate genomic comparisons that enables improved genome recovery from metagenomes through de-replication. The ISME journal, 2017. 11(12): p. 2864-2868. 184. Love, M.I., W. Huber, and S. Anders, Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome biology, 2014. 15(12): p. 1-21. 185. Stephens, M., False discovery rates: a new deal. Biostatistics, 2017. 18(2): p. 275-294. 186. Yu, G., et al., clusterProfiler: an R package for comparing biological themes among gene clusters. Omics: a journal of integrative biology, 2012. 16(5): p. 284-287. 187. Wu, T., et al., clusterProfiler 4.0: A universal enrichment tool for interpreting omics data. The Innovation, 2021. 2(3): p. 100141. 188. Pedregosa, F., et al., Scikit-learn: Machine learning in Python. the Journal of machine Learning research, 2011. 12: p. 2825-2830. 189. McFall-Ngai, M., et al., Animals in a bacterial world, a new imperative for the life sciences. Proc Natl Acad Sci U S A, 2013. 110(9): p. 3229-36. 190. Behera, J., et al., The role of gut microbiota in bone homeostasis. Bone, 2020. 135: p. 115317. 191. Xue, J., K.M. Ajuwon, and R. Fang, Mechanistic insight into the gut microbiome and its interaction with host immunity and inflammation. Animal nutrition, 2020. 6(4): p. 421-428. 192. Zheng, D., T. Liwinski, and E. Elinav, Interaction between microbiota and immunity in health and disease. Cell Res, 2020. 30(6): p. 492-506. 193. Jiao, Y., et al., Crosstalk Between Gut Microbiota and Innate Immunity and Its Implication in Autoimmune Diseases. Front Immunol, 2020. 11: p. 282. 194. Sommer, F., et al., The gut microbiota modulates energy metabolism in the hibernating brown bear Ursus arctos. Cell reports, 2016. 14(7): p. 1655-1661. 105 195. Flint, H.J., et al., The role of the gut microbiota in nutrition and health. Nature reviews Gastroenterology & hepatology, 2012. 9(10): p. 577-589. 196. Alberdi, A., et al., Do Vertebrate Gut Metagenomes Confer Rapid Ecological Adaptation? Trends Ecol Evol, 2016. 31(9): p. 689-699. 197. Kohl, K.D., A. Stengel, and M.D. Dearing, Inoculation of tannin‐degrading bacteria into novel hosts increases performance on tannin‐rich diets. Environmental Microbiology, 2016. 18(6): p. 1720-1729. 198. Sarkar, A., et al., Microbial transmission in animal social networks and the social microbiome. Nat Ecol Evol, 2020. 4(8): p. 1020-1035. 199. Raulo, A., et al., Social and environmental transmission spread different sets of gut microbes in wild mice. Nature Ecology & Evolution, 2024. 8(5): p. 972- 985. 200. Moeller, A.H., et al., Social behavior shapes the chimpanzee pan-microbiome. Sci Adv, 2016. 2(1): p. e1500997. 201. Raulo, A., et al., Social networks strongly predict the gut microbiota of wild mice. The ISME Journal, 2021. 202. Moeller, A.H., et al., Dispersal limitation promotes the diversification of the mammalian gut microbiota. Proc Natl Acad Sci U S A, 2017. 114(52): p. 13768-13773. 203. Costello, E.K., et al., The application of ecological theory toward an understanding of the human microbiome. Science, 2012. 336(6086): p. 1255- 62. 204. Krimberg, J.S., et al., Impact of social isolation on the oxytocinergic system: A systematic review and meta-analysis of rodent data. Neurosci Biobehav Rev, 2022. 134: p. 104549. 205. Mudra Rakshasa, A. and M.T. Tong, Making "Good" Choices: Social Isolation in Mice Exacerbates the Effects of Chronic Stress on Decision Making. Front Behav Neurosci, 2020. 14: p. 81. 206. Korem, T., Growth dynamics of gut microbiota in health and disease inferred from single metagenomic samples. 2015. 207. Sender, R., S. Fuchs, and R. Milo, Revised estimates for the number of human and bacteria cells in the body. PLoS biology, 2016. 14(8): p. e1002533. 106 208. Barrick, J.E. and R.E. Lenski, Genome dynamics during experimental evolution. Nature Reviews Genetics, 2013. 14(12): p. 827-839. 209. Zhao, S., et al., Adaptive Evolution within Gut Microbiomes of Healthy People. Cell Host Microbe, 2019. 25(5): p. 656-667 e8. 210. Garud, N.R., et al., Evolutionary dynamics of bacteria in the gut microbiome within and across hosts. PLoS Biol, 2019. 17(1): p. e3000102. 211. Sakoparnig, T., C. Field, and E. van Nimwegen, Whole genome phylogenies reflect the distributions of recombination rates for many bacterial species. Elife, 2021. 10. 212. Schloissnig, S., et al., Genomic variation landscape of the human gut microbiome. Nature, 2013. 493(7430): p. 45-50. 213. Greenblum, S., R. Carr, and E. Borenstein, Extensive strain-level copy-number variation across human gut microbiome species. Cell, 2015. 160(4): p. 583- 594. 214. Nayfach, S., et al., An integrated metagenomics pipeline for strain profiling reveals novel patterns of bacterial transmission and biogeography. Genome research, 2016. 26(11): p. 1612-1625. 215. Scholz, M., et al., Strain-level microbial epidemiology and population genomics from shotgun metagenomics. Nat Methods, 2016. 13(5): p. 435-8. 216. Rakoff-Nahoum, S., K.R. Foster, and L.E. Comstock, The evolution of cooperation within the gut microbiota. Nature, 2016. 533(7602): p. 255-9. 217. Hsu, R.H., et al., Microbial interaction network inference in microfluidic droplets. Cell systems, 2019. 9(3): p. 229-242. e4. 218. Frazão, N., et al., Two modes of evolution shape bacterial strain diversity in the mammalian gut for thousands of generations. Nature Communications, 2022. 13(1). 219. Frazao, N., et al., Horizontal gene transfer overrides mutation in Escherichia coli colonizing the mammalian gut. Proc Natl Acad Sci U S A, 2019. 116(36): p. 17906-17915. 220. Barroso-Batista, J., et al., The first steps of adaptation of Escherichia coli to the gut are dominated by soft sweeps. PLoS Genet, 2014. 10(3): p. e1004182. 221. Lescat, M., et al., Using long-term experimental evolution to uncover the patterns and determinants of molecular evolution of an Escherichia coli 107 natural isolate in the streptomycin-treated mouse gut. Mol Ecol, 2017. 26(7): p. 1802-1817. 222. Zhang, P., et al., Colonization of gut microbiota by plasmid-carrying bacteria is facilitated by evolutionary adaptation to antibiotic treatment. The ISME journal, 2022. 16(5): p. 1284-1293. 223. Groussin, M., et al., Elevated rates of horizontal gene transfer in the industrialized human microbiome. Cell, 2021. 224. Yilmaz, B., et al., Long-term evolution and short-term adaptation of microbiota strains and sub-strains in mice. Cell Host Microbe, 2021. 225. Zitomersky, N.L., M.J. Coyne, and L.E. Comstock, Longitudinal analysis of the prevalence, maintenance, and IgA response to species of the order Bacteroidales in the human gut. Infection and immunity, 2011. 79(5): p. 2012- 2020. 226. Cruz-Morales, P., et al., Revisiting the evolution and taxonomy of Clostridia, a phylogenomic update. Genome Biology and Evolution, 2019. 11(7): p. 2035- 2044. 227. Yutin, N. and M.Y. Galperin, A genomic update on clostridial phylogeny: G ram‐negative spore formers and other misplaced clostridia. Environmental microbiology, 2013. 15(10): p. 2631-2641. BIOGRAPHICAL SKETCH ACKNOWLEDGEMENTS TABLE OF CONTENTS LIST OF FIGURES LIST OF TABLES 1. MAJOR URINARY PROTEIN (MUP) GENE FAMILY DELETION DRIVES SEX-SPECIFIC ALTERATIONS ON THE HOUSE MOUSE GUT MICROBIOTA 1.1. Abstract 1.2. Importance 1.3. Introduction 1.4. Results 1.4.1. Deletion of the Mup gene cluster 1.4.2. Metagenomic sequencing of Mup WT and KO mice 1.4.3. Mup deletion affected the taxonomic composition of the gut microbiota in males 1.4.4. Mup deletion affected the functional composition of the gut microbiota in males 1.4.5. Significant correspondence of taxonomic and functional profiles 1.4.6. Mup deletion reduced the gut microbial diversity in males 1.4.7. Specific microbial taxa and functions were depleted in Mup-knockout males 1.5. Discussion 1.6. Methods 1.6.1. Genome Editing 1.6.2. Animals 1.6.3. Microbiota Analysis 1.6.4. Statistical Analysis 2. THE MOUSE GUT MICROBIOTA RESPONDS TO PREDATOR ODOR AND PREDICTS HOST BEHAVIOR 2.1. Abstract 2.2. Importance 2.3. Introduction 2.4. Results 2.4.1. Predator-odor exposure and social isolation gave rise to stress-associated behaviors 2.4.2. Predator-odor exposure altered the transcriptome of an endocrine and immunological tissue 2.4.3. Predator-odor exposure had a greater impact on the gut microbiota than did social isolation 2.4.4. Predator-odor exposure drove persistent alterations in the relative abundances of specific SGBs 2.4.5. Predator odor–responsive SGBs co-varied with host anti-microbial and behavioral responses 2.4.6. The gut microbiota was a better predictor of host behavior than was host VAT gene expression 2.6. Methods 2.6.1. Animals 2.6.2. Social Isolation 2.6.3. Predator Odor Exposure 2.6.4. Behavioral Assays 2.6.4.1. Open Field Test 2.6.4.2. Splash Test 2.6.4.3. Three-Chamber Test 2.6.5. Host Gene Expression 2.6.5.1. Tissue Collection and Gross Morphometry 2.6.5.2. Transcriptomic Sequencing 2.6.5.3. Transcriptomic Data Processing 2.6.6. Gut Microbiota 2.6.6.1. Fecal Collections 2.6.6.2. DNA Sequencing 2.6.6.3. Metagenomic Data Processing and Analysis 2.6.7. Statistical Analyses 3. SOCIAL ISOLATION ACCELERATES EVOLUTION IN THE MURINE GUT MICROBIOTA 3.1. Abstract 3.2. Importance 3.3. Introduction 3.4. Results & Discussion 3.4.1. Measurable intra-specific diversity in the native mouse gut microbiota 3.4.2. Social isolation accelerates divergent evolution in the gut microbiota 3.5. Conclusion 3.6. Methods 3.6.1. Animals 3.6.2. Social Isolation 3.6.3. Metagenomic Data 3.6.5. Statistical Analyses APPENDIX 1.1. Supplemental Results 1.2. Supplemental Figures 1.3. Supplemental Tables 2.1. Supplemental Figures 2.2. Supplemental Tables REFERENCES