THE INTERPLAY BETWEEN OBESITY, TASTE, AND THE MICROBIOME A Dissertation Presented to the Faculty of the Graduate School of Cornell University in Partial Fulfillment of the Requirements of the Degree of Doctor of Philosophy By Jason Richard Goodman August 2021 i © 2021 Jason Richard Goodman ii The interplay between obesity, taste, and the microbiome Jason Richard Goodman, Ph.D. Cornell University 2021 Our taste system plays the role of gatekeeper for whatever we ingest, warning us of aversive tasting foods, indicating the dangers of rotten or rancid food, and potentially poisonous bitter compounds. It also stimulates reward circuits in the brain when we ingest compounds triggering the appetitive tastes of sweet, salty, fat, and umami, indicating calories, minerals, lipids and protein. In the modern environment, where hyper palatable foods are bountiful, an altered sense of taste can lead to overconsumption of these energy dense appetitive compounds. Indeed, in the obese, researchers have noted altered taste responses, which may contribute altered eating behaviors, and drive the worldwide epidemic of overnutrition. Work in our own lab has implicated certain proinflammatory cytokines as associated with a damaged taste phenotype in mice, with obese mice having fewer taste buds than lean littermates. Where the initial inflammatory insult comes from remains a mystery, but recent work on the microbiome has associated obese phenotypes with altered microbial communities. We conceived this work to test whether an altered microbiome may be the ultimate culprit in damage to the taste system observed with obesity. We found that prebiotic supplementation to a high fat diet, which altered the composition of the microbiome, did protect mice from taste damage associated with obesity. However, we were unable to recapitulate the microbial dysbiosis present in obese mice through gavages to lean mice. This was partially due to the presence of a consortia of colonization resistant microbes that blunted the effectiveness of fecal transplants. As most fecal transplants are carried out in germ-free mice, the discovery of this consortia will be of use to other researchers without access to germ-free models and may be of interest to the burgeoning microbiome field as a whole. iii BIOGRAPHICAL SKETCH Jason Goodman was born in Philadelphia, Pennsylvania and obtained a B.S. in Microbiology with a minor in Biochemistry from Pennsylvania State University. While there he completed a co-op at GlaxoSmithKline (GSK) and Merck Inc., being named the Co-Op student of the year for work at Merck. There he developed a novel high throughput assay to assess the viability of Chlamydia in a mouse model of bacterial infection. At GSK he helped develop and execute immunohistochemical assays to quantify the effectiveness of therapeutics in models of cardiovascular disease and cancer. After graduating, he began work at Integral Molecular, a Philadelphia based biotech company, as a research associate. He credits a great deal of his scientific and leadership maturity to escalating levels of responsibility at Integral. Specifically, he developed novel assays to map the epitopes of commercially developed antibodies for clients, and lead team meetings for the group responsible for that project. Here he was also exposed to taste research for the first time, developing and executing a functional screen in feline bitter taste to de-orphan several receptors. After Integral, Jason worked as a research associate at Avid Radiopharmaceuticals, a subsidiary of Eli Lilly to develop, optimize and execute assays with the goal of finding a diagnostic for Parkinson’s Disease. After Avid, Jason joined the Dando lab at Cornell in the department of Food Science to further his growing passion for food, health, and nutrition. Here he worked at the intersection of taste, microbiology, and immunology, attempting to understand the complexities of three very complicated fields. At this time, he also co-founded Antithesis Foods, where he currently serves as CEO, working to make better-for-you food that tastes great backed by cutting edge food science. Antithesis was awarded a Phase- I Small Business Innovation Research grant from the National Science Foundation to build a portfolio of crunchy ingredients based on chickpeas. Their first product is Grabanzos, a chocolate coated crunchy snack. iv ACKNOWLEDGEMENTS “If you want to go fast, go alone. If you want to go far, go together.” I would like to thank Robin Dando, for being a patient, curious, and creative adviser with a boundless imagination. We explored the intersection of several very complicated fields, devising novel techniques, strategies, and experimental plans to counter each setback. Thank you to my committee, who expressed healthy skepticism and asked incisive questions of each of these plans, focusing and tightening the work throughout these five years. My deepest thanks to my outgoing lab mates, Ezen Choo, Corinna Noel, and Andrew Kaufman for teaching me how to be a Ph.D. student and the fundamentals of taste research. To my concurrent lab members, Fiona Harnischfeger and Anna Koh, there is no way to finish a Ph.D. without the support of your lab mates, and I could not have done it without your help. The journey was better because it was together. To my friends who I never got to see enough, thanks for being there when I had time. Lastly to my family who always made me feel like I could accomplish anything, even when everything was not working that well. v TABLE OF CONTENTS List of Figures vii List of Tables ix Background and introduction 1 Chapter 1: To detect and reject, parallel roles for taste and immunity 4 Chapter 2: Damage to Taste Buds in diet-induced obesity is attenuated in mice lacking critical inflammatory cytokines, and by prebiotic fiber. 22 Chapter 3: Population of naïve mice with a unique commensal composition are resistant to exogenous colonization by Fecal Microbiota Transplant 50 Appendix 81 Miscellaneous reagent compositions and technical information 89 vi LIST OF FIGURES I.1 Taste buds and TNFα Expression from Kaufman 3 2.1 Experimental setup to induce obesity and taste damage while attenuating it with prebiotics 25 2.2 Weight gain in C57 mice on Chow or HFD for 12 weeks 28 2.3 Taste bud counting in C57 mice on Chow or HFD for 12 weeks 29 2.4 Gene expression in taste buds of C57 mice on Chow or HFD for 12 weeks 30 2.5 Representative image of CVs of mice on HFD or Chow for 12 weeks stained for MPO positive cells identified as neutrophils 31 2.6 Sucrose response of C57 mice on Chow or HFD for 12 weeks measured by Lickometer, two bottle preference, and overall lick activity 32 2.7 Weight gain in TNFαKO mice on Chow or HFD for 12 weeks 33 2.8 Taste bud counting in TNFαKO mice on Chow or HFD for 12 weeks 34 2.9 Sucrose response of TNFαKO mice on Chow or HFD for 12 weeks measured by Lickometer, two bottle preference, and overall lick activity 35 2.10 Gene expression in taste buds of TNFαKO mice on Chow or HFD for 12 weeks 37 2.11 Counts of MPO positive cells in CVs of TNFαKO mice on Chow or HFD for 12 weeks 38 2.12 Weight gain in C57 mice on Chow or HFD + 10% Inulin for 8 weeks 39 2.13 Taste bud counting in C57 mice on Chow or HFD + 10% Inulin for 8 weeks 40 2.14 Sucrose response of C57 mice on Chow or HFD + 10% Inulin for 8 weeks measured by Lickometer, two bottle preference, and overall lick activity 41 2.15 Representative image of CVs of mice on HFD or Chow + 10% Inulin for 8 stained for MPO positive cells identified as neutrophils 42 2.16 Proposed mechanism by which diet induced obesity impacts taste bud development and licking behavior 50 3.17 Experimental design to induce dysbiosis and transfer it to conventionally raise mice via Gavage 53 3.18 Phyla level aggregation of 16S sequencing of C57 mice at baseline and after 12 weeks of Chow or HFD 57 3.19 PcoA of weighted unifrac distance matrix plotting mice at baseline and then after 12 weeks of Chow or HFD 58 3.20 Phyla relative abundance of mice to receive gavage 59 3.21 PcoA of weighted unifrac distance matrix plotting recipient mice at baseline. VP+ mice are vii highlighted 60 3.22 PcoA of Bray Curtis Dissimilarity generated from PICRUSt2 61 3.23 Species differentially abundant between VP+ and VP- subgroups 62 3.24 Lowest level classified look at Proteobacteria in recipient mice 63 3.25 Four panel PcoA of weighted unifrac distance matrix showing HFD recipient mice distance changes after gavages 64 3.26 Quantification of the change in distance between groups of recipients and groups of donors, grouped by VP status 65 3.27 Three panel PcoA of weighted unifrac distance matrix showing chow recipient mice distance changes after gavages 66 3.28 PcoA of weighted unifrac distance matrix plotting recipient mice at baseline and colored by litter. Mothers are highlighted 67 3.29 Quantification of the change in distance between groups of recipients and groups of donors, grouped by litter/mother 68 3.30 Phyla level aggregation of 16S sequencing of recipient mice at baseline grouped by mother 69 3.31 Faiths phylogenetic diversity index of litters, colored by mother. 70 3.32 Quantification of the change in distance between groups of recipients categorized by litter/mother, and a proxy of diet 71 4.33 Phyla relative abundance of mice on a HFD or Chow diet supplemented with 10% Inulin for 8 weeks 81 4.34 Microbial species differentially abundant in mice eating HFD + 10% Inulin for 8 weeks 82 4.35 Microbial Species differentially abundant in mice eating HFD for 8 weeks 83 4.36 Two bottle preference of mice drinking water or Berberine 84 4.37 qPCR detection of Akkermansia in mice fed Inulin and via coprophagia 85 4.38 Two bottle sucrose preference test on mice receiving gavage 86 4.39 MPO positivity in the CV of all study mice 87 4.40 Total liquid intake of mice receiving cecal contents by gavage 88 viii LIST OF TABLES T1. Recent studies in non-human models of inflammation and their consequences for taste 15 T2. Recent studies in human models of inflammation and their consequences for taste 20 ix Introduction and Background on Taste, Inflammation, and Obesity Background and Significance: As food intake is primarily based on sensory factors1, and excess food intake is a primary contributor to obesity2–4, understanding the mechanisms that underly these factors is crucial to human health. More than 65% of the population of the U.S. is overweight or obese25. A major driver of intake is taste6, with changes in taste acuity altering the perceived palatability of foods, and thereby impacting consumption behaviors78. Although taste perception at the behavioral level is relatively well studied8, diverse and often contradictory results argue for a deeper investigation into the underlying physiological mechanism underpinning these perception alterations. Work investigating taste buds (TBs) and the taste receptor cells (TRCs) of which they are composed, has identified a diverse slate of effectors which can alter TB and TRC number and cell type91011, with additional alterations to signaling12. Our lab directly studies TBs and has implicated various effects of obesity on taste bud abundance, function, and gene expression1314 primarily in animal models. These effects are often associated with pro-inflammatory cytokines and are otherwise attenuated in immune deficient animals. Specifically, we find damage to the taste system is likely due to a reduction in the proliferative capacity of taste cells in the obese, leading to fewer taste buds in mice made obese through consuming a HFD, (Figure i1A-C). The mechanism responsible for such a change is likely the aforementioned inflammatory response, as TNF-α is upregulated in a HFD induced model of obesity13, particularly in the taste buds (Figure i1D). Several immune pathways are implicated in the obese state, generally becoming overactive in these individuals, contributing to a persistent low grade inflammation hallmarked by increased IL-6 and TNFα1516. Recent work has implicated the human microbiome as a potential mediator of significant inter-subject variability in metabolism. In one study, subjects eating an identical meal had highly variable blood- glucose responses, partially explainable by their microbial composition17. Gut microbes are heavily implicated in the modification of hormone balance in obesity, altering levels of circulating hormones such 1 as Leptin, that contribute to appetite control18. These receptors are also highly expressed in, and may modulate taste buds19. Recent exploratory work in a large genome wide association study (GWAS) showed taste and olfactory genes were associated with specific heritable microbial taxa20. As in mice, the human taste system is influenced by obesity21,22, with the obese having a weakened sense of taste. A study in High Fat Diet (HFD) fed mice showed a rescue of taste dysfunction by a prebiotic, building off other work suggesting that diets designed to alter the microbiome can alter taste perception in mice23. A HFD can also induce “dysbiosis”, a pathological alteration in gut flora in humans and non- human animals2425. While taste cells exist in the lingual epithelium in buds, they also line the gastrointestinal tract as Solitary Chemosensory Cells (SCCs)26, in contact with commensal bacteria and the intestinal lumen. It is not surprising then, that taste cells might be acutely sensitive to the balance of microbes and their relative abundance in the microbiome. An indicator of dysbiosis, persistent low-grade inflammation, particularly acting through the cytokines Tumor Necrosis Factor alpha (TNF-α) and IL-6, potentially triggered by microbially derived lipopolysaccharides2728, have been demonstrated to reduce taste bud abundance in both humans and rodents2913. Taken together, this suggests a potential effect of diet on taste cells, mediated directly through pro- inflammatory cytokines, and triggered via dysbiosis of the microbiome. The following work was conceived to test whether such a relationship exists. 2 Key background Figures Figure i1: Experimental design scheme. C57 or TNFαKO mice were placed on Chow or HFD for 12 weeks. Post diet, they were subjected to assays to determine taste, weight, and microbiome phenotype. For the prebiotic study, a similar scheme was designed, though carried out for 8 weeks of diet. Representative images of Taste Buds of mice on i1A) Chow Diet, i1B) High Fat Diet. I1C) Enumeration of TBs in the CV of mice on Chow or HFD and i1D) the relative expression of TNFα of mice on these diets. 3 Chapter 1: To detect and reject, parallel roles for taste and immunity30 Running title: Taste and immunity Jason R. Goodman, BS1 & Robin Dando, PhD1,2 1Department of Food Science, Cornell University, Ithaca, NY 14853; 2Corresponding Author Correspondence to be sent to: Robin Dando, Department of Food Science, Cornell University, Ithaca, NY 14853, USA. Tel. 1 607 254 3319. Fax 1 607 254 4868. Email: robin.dando@cornell.edu Keywords: taste; inflammation; immunity; obesity Conflicts of Interest: Authors declare no conflicts of interest Abstract Purpose of Review: From single cells to entire organisms, biological entities are in constant communication with their surroundings, deciding what to ‘allow’ in, and what to reject. In very different ways, the immune and taste system both fulfill this function, with growing evidence suggesting a relationship between the two, through shared signaling pathways, receptors, and feedback loops. The purpose of this review was to explore recent reports on taste and immunity in model animals and in humans to explore our understanding of the interplay between these systems. Recent Findings: Acute infection in the upper airway, as with SARS-CoV-2, are associated with a proinflammatory state, and blunted taste perception. Further, recent finding highlight taste receptors working as immune sentinels throughout the body. Work in humans and mice also points to obesity impacting taste, altering taste bud abundance and composition. Summary: There is accumulating evidence that taste cells, and particularly their receptors, play a role in airway and gut immunity, responsive to invading organisms. Inflammation itself may further act on taste buds and other taste receptor expressing cells throughout the body as a form of homeostatic control. 4 5 Introduction Taste is fundamentally linked to quality of life and is vital in determining food choice. As well as to assay the appeal of foods with appetitive characteristics, the taste system chemically interrogates the food we eat, serving as a gatekeeper, protecting against the ingestion of aversive, unpalatable items that may cause harm if taken into the body. The immune system serves an analogous function, detecting things that are harmful, or that bear the molecular signals of those that have been harmful in the past, acutely activating against systemic insult as a first line of defense. In the time necessary for the adaptive immune response to be generated, a pathogen may have grown to a problematic degree within the host, and therefore the innate immune response gives an “always on” protection to the body from novel pathogens. The innate immune response utilizes an array of cells, signaling factors and proteins to isolate, destroy and recycle potential pathogens before they can reproduce to the point where their progeny may become harmful to the host. Without an index of specific pathogens to identify, the innate immune response instead relies of on detecting common molecules which are absent in the host, but which are often signs of a pathogenic entity, the classical example being lipopolysaccharides, molecules commonly found in the external membranes of Gram-negative bacteria. Upon detection, the innate immune system responds to neutralize a perceived threat with both phagocytosis, whereby a potential intruder is engulfed and ingested, and inflammation. As the basic roles of immunity and taste share some overlap in function, it is unsurprising then that recent evidence has begun to suggest that these systems may interact, and further may influence one another. Most visibly in the past year during the Covid-19 pandemic, infection with the novel coronavirus was strongly and publicly associated with anosmia, a loss of smell31, in a manner that may correlate with an activated inflammatory response32 as well as with ageusia, a loss of taste, and further loss of oral perception of irritants33. Taste cells and their canonical signaling cascades are commonly implicated in auto and hyperimmune diseases. Many genes associated with the innate immune response are over- expressed in taste cells, particularly in those isolated from taste cells bearing the molecular signals of type 6 II taste cells 34, the cells responsible for sweet, umami and bitter taste detection. In the taste buds of humans, inflammation and innate immune-associated genes are readily up-regulated in obese compared to lean individuals35. Being overweight or obese (a condition affecting over 65% of adults in the U.S), is associated with chronic low-grade inflammation, and is recently linked to alterations in taste or food intake patterns, usually promoting overconsumption, often through a loss of taste function. Taken together, evidence points toward a feedback relationship between the immune and taste systems, that may have implications for how the body functions to keep us safe from pathogens, and for our metabolic health in general. In this review, we will concentrate on recent findings (primarily those from the past 5 years) regarding immunity, inflammation, and taste to provide a snapshot of our current understanding of how these systems interact, and highlight further interesting questions that future work may explore. Search Strategy and Selection Criteria PubMed and Google Scholar were used to search for primary research articles, over the previous 5 full years from 2016 to 2020, with a small number of important articles from earlier than this also included for context. Search terms included “taste”, “inflammation”, “immunity”, “autoimmune”, “obesity”, “cancer”, and various combinations thereof. Summaries and reviews were excluded to concentrate on most recent primary literature from the lab or clinic. Inflammation and taste Inflammation as a term encompasses the activation of the immune system toward an insult. This is characterized on the macroscale by an increase in blood flow leading to redness, swelling, and an increase in temperature, along with pain and potentially a temporary loss of function36, and on the cellular scale by the recruitment of neutrophils, macrophages, and monocytes, as well as proinflammatory cytokines like Tumor Necrosis Factor alpha (TNFα)37 and Interluekin-6 (IL-6)38, and other markers of inflammation like 7 C-Reactive Protein (CRP)39 and chemokines like Monocyte Chemoattractant Protein-1 (MCP-1) 38. This contrasts with the more specific actions of the adaptive immune system acting post antigen presentation via B or T-Cells, to an already familiar threat. While in many cases these acute phase effectors resolve after insult, a chronic low-grade inflammation, or metaflammation40, has been observed in overnutrition and obesity16. Overfeeding also leads to hyperinsulemia and hyperleptinemia41, as resistance to the effects of insulin or leptin necessitates their overproduction. Evidence points to proinflammatory cytokines directly acting on the insulin42 receptor, and leptin receptors (among other mechanisms of leptin resistance4344) to affect this change. Interestingly, many proinflammatory signaling factors associated with inflammation also have their cognate receptors expressed in taste buds 454647, proferring a potential mechanism for their up- or down-regulation being associated with a modulation of taste function. TNFα Knock out (KO) mice are less sensitive to bitter stimuli than wild type animals 48, and exogenous TNFα blunts sodium taste by inhibiting sodium flux in taste buds12. Lipopolysaccharide (LPS), an inducer of acute inflammation of bacterial origin, has been utilized by multiple groups to model the influence of systemic inflammation on the taste system. Exogenous LPS resulted in a reduction in the proliferative capacity of taste buds29 which are constantly renewing in nature, and altered licking response to NaCl in mice4912, supported by reduced activity in the chorda tympani nerve which takes taste information from the anterior tongue to the brain, in response to various taste stimuli49. Serum-LPS is also elevated in mice experiencing systemic inflammation through consuming a high-fat diet (HFD)50. In one intriguing study, the bitter tastant (of recent infamy), chloroquine, was found to exhibit protective effects on pre-term birth in mice, when induced through LPS injections (inflammation is a key risk factor for pre-term labor)51. Protective effects were much weaker in animals lacking the G-protein alpha-subunit Gustducin (originally thought to be taste-specific, although now associated with many chemosensory cells throughout the body), suggesting protective effects were mediated in a manner analogous to taste signaling, via bitter receptors which were found expressed in myometrial cells. Interestingly, the primary receptor for LPS, TLR447, is also expressed in taste buds, 8 whereby taste preference is altered in mice deficient in TLR4, with KO mice displaying a reduced preference for sugars, lipids, and umami52, further suggesting that an innate inflammatory response may alter taste function. Taken together with the above work, this suggests a dual function for the LPS/TLR4 pathway; 1) as sensor of inflammation which can damage taste buds, and 2) as an integral part of the sensory transduction pathway, without which taste sensations are altered. A critical recent finding that will doubtlessly accelerate our understanding of the nexus between innate immunity and taste is that taste organoid cultures are also able to model an inflammatory response such as that in bacterial infiltration in vivo, with rapid induction of TNF and IL-6 observed in these in vitro cultures after stimulation with LPS53. These taste organoids also expressed many other classical markers of the immune response, including all members of the NF-κB protein complex (NF-κB1, NF-κB2, RelA, RelB, c-Rel,) and multiple Toll-like receptors, most markedly TLR2, 3, 4, and 5. Several autoimmune diseases are also linked to taste dysfunction, notably Sjögren’s Syndrome (SS)54, Inflammatory Bowel Disease (IBD)55, and Systemic Lupus Erythematosus (SLE) in mice56. Each of these diseases impact taste signaling in their own way. For example, in SS, patients experience an infiltration of macrophages, plasma, and T Cells into their lacrimal and salivary glands57. This leads to a reduction in salivary production, which itself reduces the ability to detect taste compounds, though not necessarily through a direct action on taste cells. In a mouse model of autoimmune disease with a phenotype akin to that of lupus or Sjögren's syndrome, taste buds were smaller, and fewer taste cells were regenerated from taste stem cells in the native turnover process the taste bud relies on to maintain fidelity58. In humans with IBD, taste sensitivity was generally blunted versus healthy controls, save for sour taste, which was elevated in IBD. Sour is thoughts to be transduced through Type III taste cells59, however most of the receptors associated with the immune response that are reported to be present in the taste bud tend to be expressed in Type II cells 604661. In human colonic mucosa, the number of bitter-receptor (T2R38) expressing cells is higher in those who are obese than lean, and is confined to cells seeming to fit an enteroendocrine phenotype62. These cells would presumably be responsible for the chemical sensing of 9 luminal contents, with their abundance strongly correlating with BMI in this sample. Interestingly, the stimulation of T2R108 receptors in enteroendocrine cells in the guts of diet-induced obese mice with a bitter extract from hops was linked to GLP-1 release, and an improvement in multiple metabolic measures including fat mass, glucose homeostasis and insulin sensitivity63. When encountering microbes in the airway, the innate immune response must detect and respond to potentially harmful invaders, in a manner thought to be partially dependent on the T2R family of bitter receptors (for review see 60). A recent report suggested that cells in the trachea expressing bitter taste receptors also expressed the tuft cell (a chemosensory cell located in the epithelium, linked to type 2 immunity through the taste-linked signaling channel TRPM5 (Transient receptor potential cation channel subfamily M member 5) 64, marker DCLK1 (microtubule-linked protein kinase 1), comprising around 4% of epithelial cells65. When isolating mRNA from these cells, sequencing revealed RNA for multiple additional taste signaling elements, as well as for multiple cytokines implicated in the immune response. Interestingly, many of the antibiotics commonly used to treat airway infections (including levofloxacin, tobramycin, and azithromycin) are also capable of activating the T2Rs (T2R1, T2R4, T2R14, and T2R20) present in the airway, validated in an in vitro FLAG tagged HEK cell system66. These receptors are expressed in smooth muscle cells within the airway walls, functioning in a manner that seems to counter the inflammatory response, to relax smooth muscles and aid in bronchodilation67. Using cultured human sinonasal epithelial cells, Lee et al68 were able to demonstrate that solitary chemosensory cells in the airway express the same T1R2/T1R3 receptor heterodimers present in taste buds used for sweet taste detection. While amino acids have a range of tastes, some D-amino acids are able to activate the T1R2/T1R3 receptor, where in the mouth this would correlate to the eliciting of a sweet taste69. Lee et al found that not only do bacterial isolates, for example Staphylococcus, from human airways produce several such T1R-activating D-amino acids (D-Leucine, D-Isoleucine, D-Phenylalanine), but D-amino acids taken from these isolates were able to inhibit biofilm formation, in a T1R-dependant manner. 10 Cancer, the inflammatory state association with it, and the treatment side-effects thereof are all associated with changes in taste in humans7071. In mice, the effects of cyclophosphamide, a common chemotherapeutic agent, are acutely damaging to taste cells, in particular type II and III cells11. This loss of taste cells seems to operate through apoptosis, and be particularly damaging to the progenitor cells responsible for resupplying the taste bud. When fractionating doses of cyclophosphamide, a practice common in cancer treatment that can alleviate some of the more negative side effects commonly encountered, loss of taste was in fact prolonged, and more severe72. As taste loss can discourage eating, leading to broad negative outcomes, and further result in a significant reduction in quality of life, careful consideration should be made of the implications of these findings. As cancer patients are at risk of cachexia (a wasting disorder characterized by severe extreme weight loss along with loss of muscle and body fat, and marked by a loss of appetite) and its associated morbidity and mortality, a recent study worked to untangle the attribution of each 73. Counter to the hypothesis that treatment which damages rapidly dividing cells would impact taste cell renewal, the authors found no impact of chemotherapy on taste detection in hospitalized patients. They did find altered taste perception in both the chemotherapy and acute inflammatory group versus healthy controls, however the marker CRP, and leukocyte counts did not correlate with dysfunction. This suggests a broader inflammatory state may be affecting both populations. Care should be taken interpreting these results as the study populations were, by the nature of the study, not standardized. Obesity, Inflammation and Taste While acute inflammation in the form of infection is well characterized, a chronic low-grade inflammation associated with obesity74 is a remarkably widespread manifestation of long-term activation of the immune system. In obesity, white adipose tissue (WAT) is broadly remodeled, and is itself a source 11 of cytokines75, and harbor for macrophages that promote systemic inflammation76. Further, pathologies associated with obesity such as atherosclerosis have an immune component themselves, with associated plaques composed of several types of immune cells, including macrophages and neutrophils77. Obesity is associated with lower levels of adiponectin, and higher levels of TNFα 78, IL-6, and C-Reactive Protein (CRP) 79. IL-6 and CRP are associated with disease complications 8081, while TNFα is associated with insulin resistance and hyperleptinemia8283. One recent study also implicated various signaling elements of taste (T1R2, T1R3, Gα-Gustducin, phospholipase C-beta 2, and TRPM5 channels) expressed in renal tissues in stimulation of the inflammasome, in a diabetic mouse model, where activation of the inflammasome could further be partially mediated by the sweet taste blocker lactisole84. A great deal of studies associate taste changes with obesity, with the preponderance of evidence supporting a reduction taste acuity22148586, although some work does show the opposite effect87 or no change at all88. Recent work from our own group suggested a reduction in taste bud abundance in both mice 13 and humans 14 with weight gain, alongside a reduction in expression of various taste-linked signaling elements in mice 14. The latter result is paralleled in humans in work from Archer et al35, where a pioneering RNA sequencing experiment examined differential expression patterns of obese and lean Caucasian women, from isolated fungiform taste papillae. In fact, 2 of 3 ontological groupings of genes found to vary significantly between subjects were those associated with the immune response, and with sensory signaling. Interestingly, in regions of the brain related to energy homeostasis (the hypothalamus and brainstem), both taste receptors (T1R3, T2R116) and taste signaling elements (Gα14, TRPM5) are down-regulated by obesity in mice89, in a manner which we might speculate seems itself homeostatic in nature. Although in an acute model of taste loss panelists tend to select foods of a higher sensory impact, and thus caloric content90, a large genome wide association study found limited evidence for an association between taste response and polymorphisms in taste genes, although GNAT3 alleles associated with greater sweet taste 12 response were negatively associated with sugar intake in one sample91. Studies of patients undergoing bariatric surgery point toward rapid changes in taste after extreme weight loss929394, which are likely inflammation-linked, as well as depending on the hormonal remodeling common in such interventions. Further work even implicates dampened CNS reward circuity linked to taste with an increase in obesity in adults 9596, which may differ from that seen in children97. Taste buds, or more specifically the population of specialized epithelial cells that make them up, are constantly renewed from a population of stem cells, which in turn produce taste progenitor cells that further differentiate into 3 functionally and morphologically distinct taste cells98, each cell type having a distinct half-life99, or supporting keratinocytes. This complex and constant state of development requires a finely tuned balance of developmental and transcriptional regulators within the taste bud to ensure the judicious turnover of taste cells within the bud. Recent work by Archer35 showed a downregulation of genes expressed in the Type II taste cells responsible for sweet, bitter or umami detection in the fungiform papillae of obese versus lean women, as well as a reduction of expression of sonic hedge-hog (SHH), a morphogen vital for taste cell development10010. Kaufman et al showed a similar decrease in taste cell developmental markers in obese mice14, with a concomitant increase in inflammatory markers and fewer taste buds in obese mice from earlier work13. Conclusions and future work Taste perception in humans is sensitive to disease states, including obesity and acute infection. Circulating factors arising from an inflammatory state can also interact with taste cells themselves, their progenitor cells, innervating nerves, and with processing within the brain. Recent work has made it clear that the taste system is plastic and responds to inflammatory insult, whether acute or chronic, and thus inflammation has a role in taste function and intake which cannot be 13 discounted as we work toward behavioral approaches to treat metabolic diseases. Further, the identification of cells strikingly similar in phenotype to those we think of as taste cells throughout the body, which are seemingly fulfilling an immune sentinel role, highlight further links between immunity and taste. Future work should take advantage of the expanding array of molecular techniques available to study taste cells in vitro, and aim for longitudinal studies of taste and immunity pre- and post-obesity, to further elucidate the complex relationship between our perception of foods, and the consequences of over consumption. 14 Table 1 Studies in non-human models of inflammation and their consequences for taste from 2016 to 2020 Reference Study Study Design Model Measures Results Conclusions Objective Ahart et al. Determine Mice on HFD or C57BL/6 mice Sucrose licking, HFD but not Obesity Both diet itself (2020) 101 whether HFD or Chow with or Diet Induced calcium imaging of reduced licking of and obesity obesity itself without Obesity (DIO) taste cells, taste gene sucrose. independently induced taste Captopril (CAP) expression. Diet independently impact taste. deficits in water for 6 inhibited TRC activity. weeks No decrease of TBs in HFD. Decrease in PLCB2 Kaufman et al Taste stem cell Mice on control C57BL/6J Male qRT-PCR, genes Reduction of expression Gene expression (2020)14 associated diets or HFD for mice, expressed in TBs in HFD-fed mice of of proliferation markers were 8 weeks. circumvallate isolated from CV of markers of proliferation- markers measure in papillae gene mice. >Ki-67 and β-catenin, significantly obese and lean expression and markers of all taste reduced in the mice cell types- PLCβ2, TBs of obese KCNQ1, NPTDase2, mice. PKD2L1 Bernard et al. Explore fat 1) Mice on C57Bl/6 male Two bottle preference DIO mice had a Orosensory (2019) 102 detection in chronic HFD mice age 8 with oil solution, LPS decreased preference for perception of fat obese rodents and 2) 4 week weeks detection, taste gene oil. Plasma LPS is affected by a treatment with expression, increased in DIO mice. fatty diet, but LPS through LPS alone did not not by a non- osmotic pump to change preference for diet LPS recreate a oil. induced chronic Proinflammatory genes proinflammatory inflammation. increase in state Circumvallate Papillate (CVP) of LPS mice with NFκB a central mediator 15 Bernard et al. Determine Mice on Chow C57 Bl / 6 Two bottle taste DIO group reduced Though markers (2019) 103 whether or HFD alone males. Age 7 preference, response to sucrose in weren’t prebiotic and weeks to start. gustometer, blood two bottle and measured, the supplementation supplemented draw, gut microbiota gustometer. Partially authors indicate reverses DIO with 10% rescued by prebiotic (P). anti- taste changes in prebiotic for 12 Proglucagon increase in inflammatory mice weeks. DIO+Probiotic group effects of prebiotic might partially explain sweet taste rescue Kaufman et al. Investigate Wild type C57, 8-week-old C57 Taste bud and Taste Obese mice have Inflammation (2018) 13 association of TNFαKO and Bl/6, B6.129S- Receptor Cell and elevated TNFα and arising from obesity with Sel 1L adipocyte Tnftm1Gkl/J, taste progenitor cell concomitant taste bud obesity, taste abundance KO fed HFD or Sel 1L-/- ,all counting, mRNA of loss. TNFα null mice associated with in mice Chow. Acute male stem cells and taste and obese-resistant mice adipose tissue injection of transduction markers. are protected. Taste reduces the # of TNFα or vehicle progenitor (Ki67+) cells taste buds into tongue. also reduced with bud through a loss. reduction in progenitor cells. Djezriri et al. Mediterranean Mice on control C57BL/6J Plasma LPS, Taste OLA decreases weight Reduction in (2018) 50 diets high in diets or HFD Female mice on Preference, Cytokine gain of HFD mice, bodyweight, polyunsaturated with poly Chow, HFD, or mRNA, fatty acid rescues CD36 pro- fats exert anti- unsaturated fat HFD + composition of tissue, expression, improves inflammatory obesity effects. in water or oleanolic acid blood glucose Glucose response, and cytokines, Mechanism vehicle. (OLA) in water tolerance test. reduces plasma LPS. glucose explored in for 16 weeks. Reduces TNFα, IL-1β, response, and mice. and IL-6 vs HFD alone. restoration of Ca2+ flux to OLA was taste acuity all abolished in HFD but through addition rescued with HFD + of OLA to diet. OLA mice in a through CD36 independent pathway. 16 Feng et al. As TRCs have Induced colitis Animal model Weight, cytokine α-Gust null mice had α-Gust serves a (2018) 104 been found in in either of IBD, using measures in colon more severe colitis than critical role in the gut, group C57Bl/6 or their dextran sulfate tissue, WT, lost more weight, protecting the investigated α-Gust null sodium (DSS) immunohistochemistry had higher tissue injury colon from whether α- counterparts. to induce (IHC) score, more inflammation. Gustducin has a inflammation in inflammatory cell role in IBD, a α-gust-KO infiltration in colons gut mice. plus an increase in TNF inflammatory M /F both used. and IFN-γ. disorder 3% DSS in Decrease in IL-5, IL-13, water for 7 IL-10 days, then mice were euthanized. Sharma et al. GPCRs in Mice treated Male FVB/N Neutrophil Migration, Inflammation: T2R CQ and Q (2017)105 Asthma are with T2R mice 8 weeks cytokines (IL- Agonists reduced differentially targets for agonists old; 4,5,9,13,17,10), lung induction of IL- inhibited most treatment. As chloroquine Injected with mechanics, 4,5,13,17, eotaxin, and chemokines and new evidence (CQ) or quinine OVA Bronchoalveolar keratinocyte cytokines, Q implicates T2R (Q) and Intraperitoneally lavage cell counts chemoattractant. Failed was overall bitter receptors, challenged with then challenged (Eosinophils, to repress TNFα, IP-10, more effective which are Ovalbumin with or without neutrophils, and RANTES. than CQ at GPCRS, in (OVA) or House agonists. macrophages, Remodeling: lower suppressing inflammatory Dust Mites lymphocytes), various collagen deposition and inflammation. pathways, bitter (HDM) Female BALB/c IHC staining for fibronectin expression taste receptor mice 8 weeks mucus accumulation by taste receptors,. agonists were old challenged via PAS Differential effects in tested as asthma Used human with HDM. inhibiting matrix treatments. neutrophils to Two models; metalloproteinases determine Prophylactic: Mechanism mechanism pre-treated with Dose dependent agonists reduction in immune cell coincides with recruitment by Q and initial HDM CQ. challenge 17 Howitt et al. Tuft cells, a gut WT and WT and Interleukin gene Upon infection with Tm, TRPM5 taste (2016) 64 immune cell TRPM5-/- mice TRPM5-/- mice, expression TRPM5-/- had reduced transduction that can detect challenged with DCLK1+ (tuft Flow cytometry cell IL-25, IL-13, fewer signaling may parasites, Tritrichomonas cells), intestinal counting Type2 innate lymphoid be used to detect contain taste Muris (Tm) in a organoids cells, and concomitant Tm, which receptors. Here model of tuft cell expansion. excited innate their helminth Additionally, lymphoid type 2 downstream infection. Tuft cells (ILC2s), signaling cells were producing IL-13 pathway is analyzed by IHC and thereby investigated in + Intestinal promoting their detail. organoids own cultured to proliferation measure Interleukin production. Rag2-/-,Ilr2γ-/- Mice lacking Th2 and ILC2 cells 18 Table 2 Studies with human models of inflammation and their taste consequences from 2016 to 2020 Reference Study Study Design Model Measures Results Conclusions Objective Kaufman et al. Investigating Taste buds n=49 (39 F, 10 Neck Change in fungiform Although not a (2020)14 changes in counting M) subjects circumference density inversely correlated direct measure of human taste from humans originally aged measured as a with neck circumference. taste buds per se`, bud abundance enrolled in a 17-18. proxy for R=-0.374, p=0.008 taste papillae in increased longitudinal Measurements bodyweight were diminished bodyweight study obtained during along with with increasing individuals designed to freshman year BMI, neck non- measure and again 4 fungiform TBs circumference, an invasively. college years later counted.. accepted measure weight gain of adiposity. were counted Schalk et al. Investigating Measure 138 patients, Sniffin’ Sticks No significant difference Inflammation, not (2018) 73 the taste, mean age 65.2 for olfaction, between patients with or chemotherapy, contribution of inflammation in three groups. recognition without impacted taste cancer, its and effect of Group 1: 42 taste test for 5 chemotherapeutical function. As treatment, chemotherapy patients basic tastes. treatment. specific measures inflammation on each in hospitalized Detection and Recognition and detection of inflammation resulting from patients with due to cancer recognition thresholds were did not correlate either, and cancer. undergoing threshold significantly different with taste concomitant chemotherapy recorded. between hospitalized dysfunction, taste- Group 2: 57 patients and healthy mechanism is dysfunction on patients controls. likely mediated malnutrition hospitalized for Cancer patients and through other an acute hospitalized patients with proinflammatory inflammatory inflammatory disease both cytokines (not disease without exhibited taste dysfunction CRP / malignancy versus healthy controls. leukocytes). Inflammatory status as measured by CRP and 19 Group 3: 39 leukocyte count did not healthy study directly associated with participants changes in taste Archer et al. Determine RNA Human Female Fungiform No difference in papillae Evidence in (2018) 35 whether there transcript Caucasians, papillae count. humans that is a difference analysis of lean (n=23) and counting, Highly divergent gene immune and taste in molecular fungiform TB obese (n=13) RNA-seq expression: PLCβ2& Sonic gene expression is makeup of biopsies BMI >30 Hedge Hog (SHH) ↓in altered in obese vs taste tissue in obese vs lean lean individuals. lean and obese Top ↑pathways associated individuals. with immune and inflammatory response. Generally ↓ expression of taste genes in obese, mostly type II. Noel et al. Investigate Participants Repeated gLMS ratings GS reduced sweet taste Weakened sense (2017)90 relationship had sweet session with of sweetness significantly vs control. of sweet taste was between taste inhibited Gymnema with various Reduction in intensity associated with an reduced sweet and sylvestre(GS) levels of GS, perception was associated increased desire taste function performed to inhibit sweet compared with with an increase in desired for sweeter and sweet ad-libitum taste function to liking of sweet sucrose in the ad-libitum beverages. solution intake mixing task varying levels foods, plus mixing task. Taste damage to an optimal versus blank in ideal An incremental 1% may thus lead to sweetness 51 participants concentration reduction in rated the desire for level, along of sugar in sweetness intensity more energy with tasting beverage from corresponded to a 0.4 g/L dense foods. various sweet ad lib mixing increase in desired sucrose. foods task. Adappa et al. Investigate Recruit CRS Human subjects 13 point PTC PTC taste score correlates Increased T2R38 (2016) 106 T2R38 positive >18 yrs (M and taste test, with biofilm formation in expression in the phenotype patients with F), immune biofilm patients without polyps airway may be status on evidence of competent CRS formation (p=.0026). associated with a biofilm immune patients with assay, T2R38 Increasing PTC taste score reduction in formation in activation, evidence of genotyping was inversely correlated biofilm formation. patients with genotype, sinonasal with biofilm formation in chronic taste tests, nonpolyploid patients. 20 rhinosinusitis and biofilm inflammation. (CRS) assay. 59 subjects 21 Chapter 2: Damage to Taste Buds in diet-induced obesity is attenuated in mice lacking critical inflammatory cytokines, and by prebiotic fiber supplementation designed to alleviate inflammation. Abstract The taste system interacts with food, sending signals to the host that can be interpreted to indicate a food’s palatability, evidence of spoilage, or sensations related to potentially harmful components. Taste receptor cells located in taste buds on the tongue are chiefly responsible for the chemical sensing of a food’s taste properties. Signals sent from taste cells can be modulated by intrinsic and extrinsic factors working at the level of the taste cell itself, the innervating nerves, or within the CNS. Among such factors are disease107108, age109–111, obesity112113, and diet114115. Modulations associated with disease can act through the inflammatory response, either actively, as with neutrophil influx116117, or more passively, via cytokines altering taste bud development and renewal139. Here, we induce obesity in wild type C57/Bl6 mice (WT) and in mice from the same genetic background lacking TNFα, to investigate changes related to obesity and inflammation in the taste bud. We further aimed to rescue diet induced changes to taste behavior with pre-biotic supplementation, aimed at disrupting the inflammatory response. We found that HFD feeding and concomitant obesity caused taste bud loss in WT mice, but did not in prebiotic supplemented, or TNFαKO mice. HFD feeding also attenuated behavioral response to sucrose broadly, however this was regardless of taste damage, suggesting the HFD itself could also alter feeding behavior alone. Reduced taste bud abundance was accompanied by an increase in neutrophils in the taste tissues of HFD-fed obese mice. Interestingly, prebiotic fed mice, though displaying increases in neutrophils, did not show a concomitant decrease in taste buds. Together, this work suggests an inflammatory milieu of TNFα and neutrophil activation are associated with obesity-induced taste bud loss. 22 Introduction: Studies in humans exploring the relationship between obesity and taste perception have generally shown an inverse relationship between BMI and suprathreshold taste detection115, recognition thresholds 94, and detection threholds85 i.e. a general weakening of taste function in the obese86. Explanations for this relationship are varied, including hedonic attenuation114, nucleus accumbens activity inhibition95, hormonal impact on taste structures19, and inflammation35 and its consequences for taste bud renewal13. It should be mentioned that some work finds the opposite87, that the obese are more sensitive to sweet stimuli, although such reports are in the minority. Many such studies in humans are hampered by small sample sizes, and non-standardized sensory measurement methods. Recent work in human taste buds studied the genes of obese and lean subjects, finding an increase in the expression of pro-inflammatory genes35. The pro-inflammatory state brought on with obesity is associated with a dysbiotic microbiome118. Recent work in Diet Induced Obese (DIO) mice, known to have a decreased preference for sucrose (at a specific level, likely implying weakened detection), showed a reversal in that phenotype with a prebiotic supplementation119 of Inulin. Inulin is a term for long chain oligofructose, also referred to as dietary fiber. It is non-digestible in the stomach and can only be broken down by commensal bacteria. Several studies indicate that supplementation with Inulin increases levels of butyrate120, resulting in a number of positive downstream metabolic consequences. Inulin supplementation can result in an increase in colonic mucus, which is readily digested by Akkermansia. The by-products of mucin degradation are anti-inflammatory short chain fatty acids (SCFAs)121 linked with positive health outcomes. This intriguing result suggests that by reversing a dysbiotic microbiome through dietary treatment, damage to the taste system may also be reversed. In this set of experiments, we used a high fat diet to induce obesity and its associated dysbiosis in mice. This treatment has been shown to cause a reduction in the abundance of taste buds in mice previously13 through a method we proposed to be associated with inflammation. We counted neutrophils as a biomarker for a pro-inflammatory state. Humans and many non-human model animals with obesity have an increased number of circulating neutrophils, key in innate 23 immunity 122. In HFD-fed obese mice, adipose tissue and liver tissue display an increased number of neutrophils123. In this study we aimed to uncover the mechanism associated with a prebiotic reversal of taste dysfunction in a similar DIO model. Methods Overview and experimental design Study Overview. In experiment 1, C57 Bl/6 (B6) and TNFα knockout mice (KO) consumed either a HFD or normal chow for 3 months, beginning at 2 months of age. Mice were assessed for the contributions of diet to taste preference and immune system activity. After 12 weeks of their respective diets, each group was tested for behavioral response to taste, then sacrificed for detailed analysis of their taste and immune systems as described below. In Experiment 2, C57 Bl/6 mice on HFD or Chow were supplemented with 10% Inulin at age 8 weeks and for 8 weeks thereafter and subjected to identical measures as in Experiment 1. 8 weeks was chosen for this experiment to compare behavioral data with recent work in a similar experimental setup by Bernard et al119. 24 Figure 1: Experimental design scheme. C57 or TNFαKO mice were placed on Chow or HFD for 12 weeks. Post diet, they were subjected to assays to determine taste, weight, and microbiome composition. For the prebiotic study, a similar scheme was designed, though carried out for 8 weeks of diet. Animals: All methods were reviewed and approved by the Cornell University institutional animal care and use committee. C57Bl/6 & TNFα KO mice obtained from Jackson Labs (Bar Harbor, ME) were bred in house, with litters divided, receiving either chow or HFD for a period of 12 weeks, beginning when mice were 8 weeks of age. Sucrose sensitivity was tested using a Davis Lickometer prior to starting dietary treatment (baseline). After 12 weeks of respective dietary treatment, mice underwent further Lickometer testing, then were assayed for sucrose intake behavior via two-bottle testing. The duration of dietary treatment was chosen to mirror other work on diet-induced gut dysbiosis124125, and therefore allow direct comparisons to previous studies. There is evidence that acute dysbiosis develops as early as after only 4 weeks on such diets125, however, for this work, we intended to induce a model of chronic, low grade inflammation in our animals more consistent with that observed in those who are obese through diet. 25 Taste Bud (TB) Counting Circumvallate (CV) papillae were excised from mice after euthanasia, with tongues fixed in 4% paraformaldehyde, then cryoprotected in 30% sucrose before being frozen in Optimal Cutting Temperature (O.C.T.) Compound (Sakura, Torrance, CA) at -80C. Sections were cut at 10 µm thickness, and then stained with primary antibodies. TBs were counted by staining for the Potassium Voltage-Gated Channel Subfamily Q Member 1 (KCNQ-1)(AB5932, Millipore Sigma, Darmstadt, Germany. 1:1000), a voltage gated potassium channel found in all taste cells. Every fifth section was counted, to ensure no taste cells were double counted. Mouse Diet Composition Macronutrient comparison HFD (TD.03584) Chow (Envigo 2018) % by % kcal % kcal from weight from Protein 20.4 15 24 Carbohydrate 36.1 26.6 58 Fat 35.2 58.4 18 Neutrophil Counting Sections were prepared as described above and stained with Anti-Myeloperoxidase (MPO) (AF3667, R&D Systems, Inc. Minneapolis, MN. 1:1000). Only MPO+ cells that surrounded a DAPI+ nucleus and were adjacent to the taste buds were counted. Lickometer Sucrose Responsivity: Mice were tested via the Davis lickometer, which measures the number of licks per second of a specific tastant an animal takes of a stimulus at varying concentrations, building up a dose/response curve for that tastant which is fit to a logistical regression model126. Licks are counted electronically and normalized on a per mouse basis. Mice were trained and acclimated to various licking tasks for 3 days prior to sucrose testing. 26 Sucrose Licks: To attain a broader measurement of “liking” and to compare with results from literature119, we tallied individual licks to any concentration of sucrose. Two bottle testing Sucrose Responsivity: A two-bottle preference test presented water and a test solution to mice for 48 hours after a 24-hour training period. Bottles were weighed before insertion into cages and locations swapped after the first 24 hour period to control for side-preference. Bottle weights were recorded after 48 hours total and a % preference calculated by dividing the amount of the test solution consumed by the total amount of liquid (test + water) consumed. Weights Mouse weights were recorded 1 week prior to commencing dietary treatments, and then each week thereafter. Each mouse’s % weight gain (the individual mouse’s weight before dietary treatment, subtracted from their weight post treatment, divided by pre-treatment) corrects for individual mouse pre weight variability. Taste Bud Isolation Mice were euthanized as described previously and their tongues excised and placed into Normal Tyrode’s solution. An enzyme cocktail (Dispase II 2.5 mg/ml, Collagenase A 1mg/ml, Elastase 0.25 mg/ml, and DNaseI 0.5mg/ml in Normal Tyrode’s solution) was injected sublingually and then tongues were incubated in Ca2+ free Tyrodes solution for 15 minutes at RT. The lingual epithelium was cut free of the surrounding tissue and then peeled away, removing the taste structures from the CV on the underside of the lingual epithelium. This structure was incubated further in Enzyme Cocktail and washed in Normal Tyrode’s. A borosilicate glass micro pipette coated in 0.2% PVP (Polyvinylpyrrolidone) was used to extract individual taste buds from the epithelium while visualized under a dissection microscope. Collected taste buds were then transferred to lysis buffer and processed for RNA extraction (Absolutely 27 RNA Nano/Microprep kit, Agilent Technologies). RNA was immediately reverse transcribed into cDNA via qScript cDNA Supermix (Quantabio, Beverly MA), and stored at -20. Taste gene primers. Primer Forward Rev βactin caccctgtgctgctcacc gcacgatttccctctcag T1R1 ctggaatggacctgaatggac agcagcagtggtgggaac T1R2 aagcatcgcctcctactcc ggctggcaactcttagaacac T1R3 gaagcatccagatgacttca gggaacagaaggacactgag PLCβ2 gagcaaatcgccaagatgat ccttgtctgtggtgaccttg TNFα acgtggaactggcagaagag gaggccatttgggaacttct IL-6 gctggagtcacagaaggagtggc ggcataacgcactaggtttgccg Gα Gustducin gcaaccacctccattgttct agaagagcccacagtctttgag Inulin Preparation Mouse diets (HFD or Chow) with 10% Inulin (XL Long Chain Inulin, Cargill, Wayzata, MN). Chow diet was ground into a powder in a high-speed grinder and mixed with Inulin at a 9:1 (Chow/Inulin) ratio. Food was refreshed in mouse cages at the longest every 10 days, or when the cages were observed to be low on food. HFD was crushed manually in thick plastic food safe bags until powderized. Inulin was added at the same ratio as chow, 9:1 (HFD/Inulin), and mixed to ensure proper dispersion. Diet was similarly refreshed at longest every 10 days. Results 28 C57 BL/6 Mice on HFD gain more weight, have fewer TBs, more neutrophils in taste tissues, and reduced response to sucrose versus chow-fed controls. After 12 weeks of eating a HFD, C57 BL/6 mice gained more weight (29.6% vs 16.9% weight gain from 8-week baseline point, P=0.001) than their chow fed controls (Fig. 2). Figure 2. C57 Bl/6 Mice on HFD gain significantly more weight than their chow controls after 12 weeks on HFD. Chow n=17, HFD n=19 29 Figure 3. C57 Bl/6 Mice on HFD have significantly fewer taste buds in their circumvallate papillae than their chow controls after 12 weeks on HFD. Chow n=19, HFD n=17 These mice had significantly fewer TBs (mean 124 TBs vs 142 TBs, p=0.001) (Fig.3), confirming an important result previously shown previously by our lab at 8 weeks on the HFD. 30 Taste bud gene expression in C57 Bl/6 mice on Chow or HFD T1R1 T1R2 T1R3 3 2 * p=0.0273 1 0 TNF PLC2 3 Chow 2 HFD 1 0 Figure 4 Taste gene expression of transduction machinery largely unchanged in C57 mice after 12 weeks on Chow or HFD. T1R3 significantly reduced. Chow n=4, HFD n=7, unpaired t-test. TB’s were isolated from the CV (Circumvallate) papillae of mice, with mRNA quantification by qPCR using B-Actin as an endogenous control gene. Expression was broadly similar across tested genes with only T1R3 expression reduced in mice eating HFD (p=0.027) (Fig.4). 31 Relative Expression (fold) Relative Expression (fold) Figure 5. Representative image of right side of Circumvallate Papillae of C57 Bl/6 Mouse on A) Chow or B) HFD for 12 weeks. C) Counting of MPO+ cells shows C57 Bl/6 Mice on HFD have significantly more MPO in their taste Buds. Chow n=12, HFD n=8 Immunohistochemical (IHC) staining of TBs for MPO positive cells was performed to ascertain the degree of immune infiltration of neutrophils into the taste field. HFD fed mice exhibited significantly more neutrophils than mice maintained on the chow diet, around double in the HFD-fed animals (mean 65.92 chow vs 129.8 HFD, p<0.001, Fig. 5), supporting a hypothesis that innate immune cells may be associated with taste dysfunction. 32 F igure 6. A) C57 Bl/6 Mice on HFD have a significantly reduced response to sucrose at multiple concentrations by Lickometer Chow n=21, HFD n=23. B) By two-bottle testing at 0.025M sucrose, p reference is significantly reduced in C57 Bl/6 Mice on HFD (n=21) versus mice on Chow (n=21). C) C57 Bl/6 Mice on HFD lick sucrose fewer times at multiple concentrations versus mice on Chow. Chow n=21, H FD n=23 33 Interestingly, these mice had a broadly attenuated response to sucrose as assessed via Lickometer (EC50 0.266 chow vs 0.350 HFD, p=0.026, Fig.6A), two bottle preference testing (mean preference 88.38% chow vs 71.52% HFD, p<0.001, Fig. 6B), and reduction in ‘liking’ sucrose as defined by Bernard119 as a reduced total # of sucrose licks compared to chow controls (mean 401.4 chow vs 207.1 HFD, p<0.001, Fig. 6C), providing behavioral evidence for taste damage to complement earlier evidence of a morphological shift in obese mice. TNFαKO mice, made obese through HFD do not display taste bud damage, but exhibit a reduction in response to sucrose similar to that of their immune competent counterparts. Figure 7. TNFαKO mice on HFD gain significantly more weight compared with chow controls after 12 weeks on HFD. Chow n=10, HFD n=11 While TNFαKO mice on HFD may suffer fewer negative metabolic side effects due to their diet than wild type controls127, in our experiments TNFαKO mice eating HFD did gain more weight than control TNFαKO mice on chow (chow 17.7% vs HFD 25.3%, p=0.009, Fig. 7). 34 Figure 8. TNFαKO mice on HFD have a similar abundance of taste buds in their circumvallate papillae versus chow -fed controls after 12 weeks on HFD. Chow n=9, HFD n=10 However, while C57 mice on HFD had fewer taste buds than when on regular chow (Fig.3), TNFαKO mice on HFD did not see such a loss (chow 108.3 vs HFD 115.2, p=0.30, Fig.8), as has been previously reported13. Despite this, these mice still exhibited some behavioral attenuation to sweet taste, which may have been an effect of some sweetness present within the HFD, which was higher than that of the chow diet (HFD sucrose 15.0%, vs 0% sucrose in chow diet). 35 Figure 9. A) TNFαKO mice on HFD have a significantly reduced response to sucrose at multiple concentrations by Lickometer Chow n=12, HFD n=11. B) By two-bottle testing at 0.025M sucrose, preference i s significantly reduced in Mice on HFD (n=9) versus mice on Chow (n=7). C) TNFαKO mice on HFD lick sucrose fewer times at multiple concentrations versus mice on Chow. Chow n=21, HFD n=15 TNFαKO mice made obese through a HFD have decreased sensitivity to sucrose as measured by Davis Lickometer (Fig. 9A), shown in the figure by a shift in EC50 to higher concentrations in these animals 36 (EC50 0.225 chow vs 0.344 HFD, p=0.023). In addition, these mice also exhibited a reduced preference for 0.025 M sucrose in a two-bottle test (74.89% HFD vs 94.43% Chow, p<.001, Fig.9B). TNFαKO mice eating HFD mice also display a reduced number of total sucrose licks throughout the entire test Lickometer test period (159 HFD vs 397 Chow, p<0.0001, Fig. 9C) 37 Figure 10 Gene expression of taste transduction machinery largely unchanged in TNFαKO mice after 12 weeks on Chow or HFD. PLCb2 is significantly decreased. Chow n=8, HFD n=8 Broadly, gene expression was similar in the treatment groups of these mice (Fig.10), with PLCβ2 expression decreased (p=0.049) in HFD fed TNFα KO animals. 38 Figure 11. TNFα KO Mice have fewer MPO+ cells in their taste buds. In this study, TNFα KO mice on HFD tended had fewer MPO+ cells than their Chow controls, though not significantly. Chow n=6, HFD n=5 While WT C57 mice eating a HFD exhibited an increase in MPO+ cells in the taste field (Fig.5), the immune attenuated mice discussed here did not display a difference between HFD or chow fed littermates (Fig. 11), indicating that neutrophil induction may be dependent on TNFα. 39 C57 Bl/6 mice fed a prebiotic in addition to an obesogenic diet were protected from TB damage but displayed reduced liking for sucrose and increased Neutrophil infiltration into taste tissues. Figure 6. Mice eating HFD with 10% Inulin gain significantly more weight than mice on Chow with 10% Inulin. Inulin Chow n=9, Inulin HFD n=13. Unpaired T-Test. C57 Bl/6 mice were fed Chow or HFD supplemented with 10% Inulin for 8-weeks to determine whether a prebiotic could rescue taste damage displayed in mice on HFD alone (Fig.3). After 8-weeks, High Fat Diet-Inulin (HFD-I) fed mice gained significantly more weight than Chow Inulin (Chow-I) controls (27% HFD-I vs 13% Chow-I, p <0.0001) Fig.12). 40 Figure 7. After 8-weeks of eating Chow or HFD with 10% Inulin, there is no difference in TBs Inulin Chow n=8, Inulin HFD n=12 Unpaired T-Test. However, in contrast to results in HFD alone mice, the prebiotic fed mice on HFD did not lose taste buds when compared to control animals (125.8 HFD-I vs. 133.9 Chow-I, p=0.315 Fig 13.) 41 Figure 14. A) Mice eating diets with 10% Inulin do not show a significant difference in their response to sucrose via Lickometer Inulin Chow n=9 Inulin HFD n=9, or B) a difference in sucrose preference at 0.025M Inulin Chow n=9 Inulin HFD n=9, but C) C57 mice eating HFD with 10% Inulin lick sucrose less at multiple concentrations versus mice eating Chow with 10% Inulin, Inulin Chow n=9, Inulin HFD n=10. 42 These mice also did not show a significant difference in sucrose response by Lickometer (EC50 0.196 Chow-I vs 0.285 HFD-I, p=0.069, Fig. 14A) or 0.025M sucrose preference by two-bottle test (66% Chow-I vs 63% HFD-I, p=0.608, Fig. 14B), indicating no behavioral shift in taste responses were evident when mice were supplemented with prebiotic. However, the lickometer test did show a trend toward a higher EC50, and when all sucrose licks were summed to ascertain ‘liking’ of sucrose in HFD-I mice, we found that these animals scored lower than Chow-I mice (577 Chow-I, vs 204 HFD-I, p=0.001 Fig. 14C). This ‘liking’ attenuation is consistence with all mice in these experiments on HFD regardless of genotype or Inulin supplementation. Figure 15. Representative image of left side of Circumvallate Papillae of C57 Bl/6 Mouse on A) Chow + 10% Inulin or B) HFD + 10% Inulin for 12 weeks. C) Counting of MPO+ cells shows Mice eating HFD with 10% Inulin have significantly more neutrophils in their taste buds. Chow n=8 HFD n=12. HFD + Inulin fed mice showed an increase in positivity for Myeloperoxidase (MPO), a component of neutrophil granules (Fig. 15), indicative of some level of activation of an innate immune response, as well as a decrease in sucrose ‘liking’ (Fig 14.C) as with all other mice in experiments consuming HFD. While we did see an increase in MPO in HFD-I fed mice (Fig.15 C), as in regular HFD feeding (Fig. 6) this did not correlate with a behavioral change as measured by Lickometer (Fig. 14A) or 2 bottle preference (Fig. 14B) testing with sucrose. 43 Discussion In this study, we saw taste bud loss in DIO mice but not in TNFαKO and prebiotic fed DIO mice. This result accords with an inflammatory hypothesis for taste bud damage, which is supported by evidence in the literature. However, the precise mechanism remains unknown, and the behavioral impacts of such taste damage, in this mouse model, are somewhat complicated due to the composition of the HFD itself, formulated to approximate a western diet, and thus containing some level of sucrose as well as high levels of lipids. Previous work from our group showed a similar decrease in TB abundance in DIO mice13, but this work did not attempt to discern whether differences observed were behaviorally impactful. Other groups studying a DIO animal model of taste have shown various effects of HFD on the taste system. Ahart et al, showed a differential effect of the diet itself in addition to concomitant obesity on modulating taste101. In that study HFD fed mice which become obese showed a reduced number of licks to sucrose, saccharin, and acesulfame k which we were able to replicate here for sucrose. However, they also show that regardless of obesity status, those mice eating HFD had reduced lick scores for sucrose. The HFD used there was not specifically disclosed, but likely contained between 9-12% sucrose. Bernard et al103 also showed a reduction in the number of licks toward sucrose in mice fed a HFD, which contained 5.6% sucrose, and a difference in sucrose preference as we were also able to show here. However, we were unable to reproduce the restoration of sucrose preference by prebiotic as in Bernard, which may be due to difference in experimental setup, critically that our sucrose preference test concentration was lower (0.86% vs 1%) and our HFD source was lard versus palm oil. Taken together, sweet taste response attenuation is likely partially explained by sucrose in the western diet used to induce obesity in the majority of diet-induced obese mouse studies, as there is evidence for a reduction in liking of sucrose after repeated exposure128114129. Weiss et al, fed a “High Energy Diet” (HED) to rats to induce obesity, which was similarly formulated to the diet we used here, and demonstrated an overall blunted neural response across taste stimuli in these 44 rats130. Maliphol et al showed an attenuated response to sweet stimuli in harvested taste receptor cells (TRCs) from obese C57 Bl/6 mice via calcium flux and by two bottle testing, again analogous to results we were able to show here131. Generalized attenuation of taste signals with obesity was also observed by Hardikar et al in obese humans132, with obese subjects response to sweet taste degrading faster than lean subjects, with a lower peak signal. Interestingly, the signal onset intensity was no lower in obese vs. lean humans, indicating that signals from the lingual taste system should be similar. This would seem to contradict a hypothesis based on signal degradation from damage to the periphery as suggested here and in other animal models of DIO above. However, the signal peak strength and intensity duration are likely each affected independently by TB or TRC numbers, receptor gene expression, as well as hormones like Leptin19, the circulating level of which is altered in obesity133 and may be correlated with sweet taste perception86134. As obesity is associated with a chronic proinflammatory state16, we used an immune deficient mouse model, B6.129S-Tnftm1Gkl/JTNFα and measured neutrophils in the taste field to assess the immune contribution to taste damage with obesity. MPO is a classical histological marker of neutrophils and has some association with obesity, as mice expressing human MPO display an increase in blood lipid markers for atherosclerosis and increased weight gain on a high fat diet vs control135. In this study more MPO+ labelled neutrophils were observed in the taste field of mice fed a HFD, but not in TNFαKO mice, therefore it is likely that TNFα is required for the accumulation of neutrophils. Although neutrophils are key in responding to acute damage, they are known to circulate at higher concentrations in the morbidly obese122, as a component of the persistent low-grade inflammation associated with obesity. Here we show taste bud loss in C57 Bl/6 mice eating HFD was associated with an infiltration of neutrophils (Fig.5). However, taste bud loss, likely through a reduction in the proliferative capacity of taste buds, was observed only in HFD fed mice (Fig.3), not in HFD + Inulin fed mice (Fig.13). This was 45 despite an accumulation of neutrophils in these animals (Fig.15), suggesting that such a response may not be essential for degradation of taste cells. Why then might Inulin be protective? After ingestion, Inulin is fermented to SCFAs by microbes in the colon136. SCFAs, chiefly acetic, propionic, and butyric acids have a broad impact on the functioning of the immune system. They are taken up by intestinal epithelial cells and generally display anti-inflammatory properties137120138. Weitkunat et al. fed C57 Bl/6 mice a HFD supplemented with Inulin or with various SCFAs and ratios thereof, finding that SCFAs had a similar anti-inflammatory effect as Inulin139, indicating that Inulin’s fermentation products, and not Inulin itself, are immune effectors. Feeding effects in that study included changes in body temperature, mitochondrial activity, and fatty acid metabolism. This conclusion was supported by Besten et al. and mechanistically expanded by demonstrating that beneficial effects are dependent on the peroxisome proliferator-activated receptor-γ (PPARγ). In humans, Inulin has been shown to reduce inflammatory markers (endotoxin, CRP, proinflammatory cytokines) generally138. Inulin feeding may also function by inhibiting the translocation of bacterial contents, primarily LPS, from the gut lumen, which may also be occurring in HFD fed animals125140 and humans with type 2 diabetes (T2D)141. In a model of intestinal inflammation using LPS supplementation, mice displayed reduced licking and neural response to sweet stimuli, and elevated neutrophils in the small intestine and colon142. The prebiotic effects of Inulin may act via resident microbes like Akkermansia muciniphila143, which can increase intestinal barrier strength, thereby reducing generalized inflammation due to diet. Taken together, this suggests a protective effect of inulin supplementation and indicates that while neutrophils may be a marker of taste damage, they are not sufficient or causative of such pathophysiology alone. What then might be the mechanism for TB loss? Taste buds are composed of 50-100 individual specialized epithelial cells144, which are further subdivided into three cell types (reviewed by Finger and Simon, 2000). Type 1 cells, which are the most abundant cell type, are supporting, NTPDase containing 46 cells145. Type II ‘receptor’ cells sense sweet, umami146, or bitter compounds147, depending upon receptor expression148. Finally, type III cells which respond to sour tastes59, and are the only taste cells which form classical synapses149. Each cell type within the bud has a distinct abundance and longevity99, with an average life span of 10-20 days. TCs are regenerated from keratinocyte stem cells150 adjacent to taste buds which migrate to TBs where their gene expression profiles are altered, triggering differentiate into one of the three cell types described151. Here we see differences in the total number of TBs between obese and lean mice, with relatively similar expression of taste related genes. Cancer is associated with dysgeusia (reviewed71), which can either be caused directly by acute treatment of the disease, which is typically chemotherapeutic or radiation based, or by effects of the disease itself. In one study of 51 patients undergoing radiation therapy (RT), a significant decrease in response to all tastes was found after five weeks of an initial RT152 dose which recovered 11 weeks after the first dose. In the same study, the authors subjected rats to a single dose of RT and showed TB loss after 8 days which eventually recovered. Nerves were unaffected, causing the authors to conclude that the RT affected TBs specifically. A similar design was tested in mice using roughly half the RT dose (8 vs 15 Gy) and measuring Ki-67 as an indicator of proliferation by Nguyen et al. with similar findings153. In a chemotherapeutic pathway, taste progenitor cells may fail to differentiate into receptor cells, remaining as keratinocytes. Chemotherapeutics that targets stem cell renewal via Hedgehog (HH) signaling are deployed against basal cell carcinoma. Sekulic et al. reported >30% of patients treated with Vismodegib, a HH signaling inhibitor, reported dysguesia154. In mice, HH inhibitors almost completely ablated typical TB morphology and taste signaling through the innervating nerve155. However, Keratin-8 positive cells did remain in TBs, where in fact some were hyperkeratinized, suggesting that cellular renewal in lingual tissues was proceeding away from gustatory cells and toward keratinocytes in the absence of HH. 47 Interestingly, Cancer itself is also associated with an imbalance of proinflammatory cytokines156 which have an impact on feeding15715873. Inflammatory diseases and their effect on taste are well known and reviewed in a recent article by the author30. TB loss is also observed in acute nerve injury or denervation of the tongue. While innervation is not required for TB development, it is required for TB maintenance in adulthood159. Denervation of taste buds through severing either the Glossopharyngeal or Chorda Tympani nerve leads to rapid apoptosis of TBs in the CV160 and Fungiform Papillae (Guth L. 1971) respectively. McCluskey et al showed an influx of neutrophils and macrophages to the denervated and non-denervated control sides of tongues, with taste deficits occurring on both sides. Interestingly, using diet to inhibit neutrophil accumulation protected mice from taste dysfunction116, implicating these immune cells as effectors. Work by Zhu et al28 expanded on this by inducing acute inflammation through feeding rats LPS in a single overnight session. 7 days later, sweet nerve recording response was significantly reduced. Further work by Pittman et al49 used chronic exposure to LPS, and showed similar sweet taste deficits in nerve recording and lick testing, with a concomitant increase in gut neutrophils, though without a change in taste transduction genes. Interestingly, intraperitoneal (IP) injection of LPS by Cohn et al29. increased proinflammatory cytokines in TBs, and reduced TB abundance and markers for taste progenitor cells. Aguliar-Valles et al. injected LPS intra-peritoneally in mice and observed ‘depression like behavior’ and reduced physical activity44. As we describe here, mice eating HFD were less motivated to lick sucrose by behavior test. Aguliar-Valles implicated brain transmigrating neutrophils in this behavior, as it was reversible with neutropenia or by leptin inhibition. Neutrophils act to phagocytose microbes (reviewed 161162) but also secrete effector serine proteases, such as neutrophil elastase (NE) through neutrophil extracellular traps (NETs)162. Recent work on this secreted elastase implicated it as an effector in several proinflammatory pathways in host cells, not just in the intended microbial target163. Talukdar et al.123 showed NE increasing in DIO mice after 3d of HFD. In the same paper, the authors treated WT or TLR4 -/- macrophages with NE or LPS, finding NE and LPS had a 48 directionally identical TLR4 dependent effect (↑ Tnfα, Il1b,Cxcl1, Il6). Other groups have similarly found NE inducing inflammation through the TLR4 pathway164165. As demonstrated by Cohn, activation of the TLR4 pathway reduces TB number via taste progenitor cells29. As we show empirically here, neutrophils are increased in HFD and HFD + Inulin C57 Bl/6 mice, but not in TNFαKO mice. While there is some evidence implicating TNFα in neutrophil recruitment166–168, the role of Inulin supplementation had no effect on their accumulation. However, despite infiltrating neutrophils (Fig. 15), Inulin fed mice did not show a significant loss in taste buds (Fig. 13). As described above, Inulin is fermented to SCFAs in the colon after ingestion. Two studies report that SCFAs (chiefly butyrate and propionate) reduces the production of TNFα, as well as other proinflammatory cytokines, from neutrophils stimulated by LPS169170. As HFD feeding can acutely increase the level of transmigrating LPS171172 from the gut, and the obese have higher levels of circulating LPS173, we proffer the following mechanism; HFD induces inflammation acutely, or chronically through obesity, via activated neutrophils secreting TNFα and NE, in addition to circulating LPS itself from the gut. These effectors can be partially attenuated by the mechanism of prebiotics; gut barrier strengthening to reduce LPS translocation and the anti-inflammatory effect of SCFAs on neutrophils, which can explain the protective effect of Inulin on taste buds in these mice. 49 Figure 16. Proposed mechanism: Taste bud loss and sweet behavioral changes proceed along two pathways, acute, and chronic. In the acute pathway, a High Fat Diet can reduce the thickness of the mucous membrane in the gut, and lead to LPS translocation which causes acute inflammation. This increases circulating proinflammatory cytokines like TNFα, and neutrophils which by the effector action of NETS, can contribute to the polarization of taste progenitor cells toward keratinization and away from a taste receptor cell fate. In the chronic pathway, inflammation is primarily due to the action of proinflammatory cytokines released by adipose tissue. The effects of these and other circulating hormones, like leptin, on signal processing areas in the brain on taste behavior also likely contribute substantially to taste perception. Conclusions Here we describe a series of experiments that seek to uncover the differential effects of diet and inflammation on the taste system. We find that taste bud abundance is likely impacted by inflammatory tone, which can be modified by prebiotics, and that this can impact taste preference. However, taste preference was also influenced by the type of diet used to conduct experiments. Further, the motivation to lick sweet substances may be affected by eating a High Fat Diet, a finding now supported across several papers. Future work should aim to more deeply understand the effect of inflammatory mediators of neutrophils in the taste field and elucidate mechanisms to reduce their activation. 50 Chapter 3 Population of naïve mice with a unique commensal composition are resistant to exogenous colonization by Fecal Microbiota Transplant Abstract A well-documented effect of a high-fat diet (HFD) is a shift in the gut microbiome toward a ‘dysbiotic’ phenotype, with an increased relative abundance of Firmicutes over Bacteroides when compared to littermates maintained on regular chow. It has been demonstrated previously that such a dysbiotic gut phenotype can be transplanted to naïve mice and is sufficient to induce weight gain in the host. In this study, we transferred the cecal contents of obese mice into naïve, conventionally housed (non germ-free) mice maintained on chow to test whether these animals would recapitulate taste deficiency observed in obese mice. While taste phenotype was inconclusive, measurements of recipient microbiomes post transfer gave new insights into the stability of fecal microbiota transfer (FMT) in conventionally raised mice. We further identified Akkermansia muciniphila, Parabacteroides distasonis, Clostridium citroniae and others as highly overrepresented in a subgroup of mice which best resisted shifts toward the dysbiotic donor animals. As this work was performed in conventionally raised mice, rather than germ-free animals, it affords an opportunity to record changes in an otherwise stable commensal population acutely challenged by a divergent population. Recipient mice flora remained more similar to control mice maintained on chow than donor mice on HFD after three gavages, with those presenting high levels of Akkermansia muciniphila, Parabacteroides distasonis, Clostridium citroniae notably more resistant to shifts. Taken together, these results suggest a strong bias toward diet over acute transfer in altering the host microbiome, and further identifies marker species associated with a unique phenotype resistant to dysbiotic FMT. 51 Introduction: Fecal transplants into immune naïve animals have been used to show the sufficiency of donor microbiota to recapitulate metabolic phenotypes in otherwise healthy animals. There are striking examples where insulin resistance124, and obesity174 are initiated in a donor animal via diet, but transferred to recipient mice by microbiota transplant alone. Most studies of this type utilize germ free mice, which have never been exposed to bacteria, more readily allowing only the transplanted microbiota to take hold. However, the unique state of germ free animals results in an underdeveloped immune system and other developmental deficits175 that complicate the drawing of broader conclusions from such animals. Likewise, there remains some difficulty in extrapolating results to humans, where an active microbiome would be the norm. Work in rats has shown that fecal transplants from donors into conventional, non- germ-free animals is sufficient to shift the microbiome of recipients to resemble that of the donor in the short (1 month), and long (3 months) term176. Several thousand papers177 have been published showing the effects of various compounds on the microbiome. As the human diet directly impacts the fitness of gut microbes, diet and its consequences, particularly obesity, are of high interest. Several papers demonstrate an association between obesity and metabolic syndrome with changes in the microbiome 140,178,179. Some of the most compelling evidence of such associations rests on the transfer of cecal contents of obese mice into germ-free (GF) lean mice. Interestingly, despite consuming a relatively healthy diet, these mice go on to develop obesity and its concomitant metabolic comorbidities179. The striking connection between obesity and the microbiome was first laid out in leptin deficient mice180. Leptin, a hormone which inhibits hunger and promotes satiety, causes obesity in these knockout mice via overeating. Compared with lean mice, leptin deficient obese mice showed a significant increase in gut composition of Firmicutes, and a decrease in Bacteroidetes. Further work showed that these obese associated microbial communities can harvest additional caloric energy from the same dietary intake, thus making weight loss more difficult, and further entrenching an obese state174. When an obese mouse’s 52 microbiota is transferred to germ free mice, the obese phenotype is recapitulated in mice consuming a regular, healthy diet174. Obesity frequently co-occurs with a chronic low grade inflammation15, with adipose tissue harboring immune cells and generating proinflammatory cytokines like IL-6 and TNFα (reviewed79). Interestingly, triggering inflammatory pathways in mice using Lipopolysaccharides (LPS), a large surface exposed molecule on certain bacteria, as one might observe in an acute inflammatory event, inhibits taste bud renewal29. TNFα upregulation has been linked to a decrease in taste bud abundance and life span29, obesity27, and insulin resistance (reviewed15). We have shown in a diet induced obesity model that TNFα expression is inversely proportional to taste bud abundance14. As inflammatory disorders impact the taste system (Reviewed by Goodman et al. 2021) and are associated with dysbiotic microbiomes, we postulated that the two might be linked. This work was conceived to test whether transferring the microbiota of taste deficient, obese mice to lean mice would accordingly transfer such a phenotype and further elucidate the effect of microbial transfer to non-germ free mice. Methods Animals / Experimental Design Figure 17. Experimental design detailing the induction of dysbiotic diet in mice in Experiment 1 and the scheme for transferring microbes to conventionally raised mice over 3 gavages in Experiment 2. Mice were fed either a HF or Chow diet starting at age 8 weeks and for 12 weeks thereafter. Cecal contents from each group was collected, pooled, and gavaged three times into conventionally raised mice 53 maintained on chow at weeks 5,6, and 7 of their lives. Fecal samples were obtained to monitor success of microbiota transfer and taste phenotypes were measured post gavage. Cecal content collection A 50% Glycerol solution in PBS was prepared and autoclaved for 35 minutes to ensure sterility. Aliquots of 500 µL were prepared in sterile Eppendorf tubes. After sacrifice and dissections, Ceca were isolated from the rest of the gut, excising the connected small and large intestines, then moved to a sterile plastic disposable dish and washed with PBS to remove external detritus. Clean ceca were moved to another clean dish and 500 µL PBS/Glycerol added. A scissors, pre-cleaned in 70% Ethanol, was used to open the cecum by cutting across its lateral face. Cecal contents were washed out by continually pipetting PBS/Glycerol solution in and around the organ. Finally, contents were collected, put on ice, and rapidly moved to -80 within 60 minutes. Cecal content gavage Extracted cecal contents from HFD treated mice was thawed on ice and diluted 1:5 in autoclaved PBS/Glycerol prior to gavage. 150 uL of this diluted material was gavaged via an 18 Gauge, 5 cm needle with ball tip (Kent Scientific Corp, Torrington, CT). Mice were monitored for evidence of aspiration and observed for 7 minutes post gavage to ensure a successful procedure without harm. Fecal samples were collected immediately prior to each gavage to ascertain the extent of successful donor colonization. 16S rRNA gene sequencing and Microbiome analysis pipeline The 16s rRNA gene was used to determine gut flora composition, isolated in the following manner: Fecal samples were collected and frozen at -80○C before processing for microbial DNA isolation (PowerFecal DNA isolation kit, MO BIO laboratories Inc, Carlsbad CA). Post extraction, PCR was performed (PCR stages detailed in appendix) using primers specific for the V4 variable region (515F181 and 806R182) and containing illumina nextera adapter overhangs to generate genera/species specific amplicons. A second step PCR reaction appended sample specific barcodes which was performed by Biotechnology Resource 54 Center (BRC) Genomics Facility at the Cornell Institute of Biotechnology (http://www.biotech.cornell.edu/brc/genomics-facility). The facility normalized samples by concentration, pooled, and run on the MiSeq sequencing platform utilizing 250 x 250 paired end sequencing. Sequencing files were run through the QIIME2183 (Quantitative Insights for Microbial Ecology) analysis pipeline. Briefly, files were de-multiplexed by barcode identifier and quality filtered for ambiguous base calls and low-quality reads. Sequences were identified and placed into ASVs using the using the DADA2184 algorithm and taxonomically matched using the GreenGenes database185. Prior to downstream analysis, samples were rarefied to the lowest abundant sample (24,000 reads) to correct for variation in sequencing depth. Sequences were aligned using the mafft186 function and filtered for variable positions using mask187. The aligned sequences were joined to a tree using fasttree188 and then mid-point rooted using ‘phylogeny’. β-diversity was determined using the weighted and unweighted Unifrac189 distances between samples. Unifrac uses the evolutionary distance between two identified taxa, adding up all of the evolutionary branchpoints pairwise between compared samples. Weighted unifrac takes into account species relative abundance when generating distances while unweighted unifrac does not. Overhang adapter for use with Illumina Nextera sequencing TCGTCGGCAGC GTCAGATGTGTATAAGAGACAG 515F Primer (Parada et al. 2016) GTGYCAGCMGCGCGGTAA Overhang adapter for use with Illumina Nextera sequencing GTCTCGTCGGGCTCGGAGATGTGTATAAGAGACAG 806R Primer (Apprill et al. 2015) GGACTACNVGGGTWTCTAAT 16s rRNA Gene PCR for microbiome sequencing amplicons 2.5 uL Microbioal DNA (5 ng/uL) extracted via PowerFecal DNA isolation kit (MO BIO laboratories Inc, Carlsbad CA). 5 uL Forward Primer (515F) 5 uL Reverse Primer (806R) 12.5 uL 2x KAPA Hifi HotStart Ready Mix 1. 94°C 3 minutes 55 2. 94°C 45 seconds 3. 60°C 60 seconds 4. 72°C 90 seconds 5. Repeat steps 2-4 35 times 6. 72°C 10 minutes 4°C HOLD Predictive genomics via PICRUSt2. We used the PICRUSt2(Phylogenetic Investigation of Communities by Reconstruction of Unobserved States)190–192 plugin embedded in Qiime2 to predict the metagenome of our samples and ascertain whether observed differences in community structure also differ in the presence or absence of certain metabolic pathways. A PcoA plot was created using a Bray Curtis dissimilarity matrix generated from estimated metacyc pathway abundance for each sample. ASVs were aligned to a reference tree using SEPP (SAT´e-Enabled Phylogenetic Placement)193. Caution is warranted as these metagenomes are calculated based on abundance data from 16S amplicons. Any errors or biases in these data will be present in this extrapolation Statistics Clustering Algorithm To determine whether specific clusters of samples were distinct from other clusters, a Permanova test was performed via QIIME2 with 999 permutations173. Distance metrics significance To determine whether movement toward or away from donor clusters were significant, we used weighted unifrac distances generated as described above. Distances from individual mice in each subgroup were compared to HFD donors at baseline, and then after each first gavage. We then subtracted the distances of each subsequent points to generate a ‘change in distance toward donor’ metric. A 0 on this metric would indicate no movement toward the position of the donors. We performed a one sample Wilcoxon signed rank test of each group for each gavage timepoint compared to a hypothetical median 0 value. Differential Abundance 56 To surface the specific microbes which differed significantly between groups, we used the Qiime2 package analysis of composition of microbiomes (ANCOM)173. ANCOM corrects for the compositional effect of using relative abundance data when comparing across groups and reports which taxa are differentially abundant and how different that abundance is. Faiths Phylogenetic Diversity. Phylogenetic diversity was calculated in Qiime2 using the metric described by Faith in 1992194 and compared between groups using a one-way ANOVA. Results Figure 18. After 12 weeks, mice on chow and HFD have distinct microbiomes, with mice on HFD changing to overemphasize Firmicutes over Bacteroidetes. HFD Feeding alters the microbiome of mice. After eating a HFD for 12 weeks, obese mice over emphasized Firmicutes (80.24% relative abundance versus chow mice at 26.36%.). HFD feeding also reduced Bacteroidetes to 13.54% versus 68.02% in mice fed chow (Fig.18). Chow fed mice did not deviate significantly from baseline in the 3-month period between sequencing timepoints. 57 Figure 19. PCoA plot of weighted unifrac of individual mice microbiomes at baseline (black circles), after 12 weeks of chow (grey square), and after 12 weeks of HFD (green squares). Cecal contents of these dieted mice were used as input gavages in experiment 2. HFD fed mice(green squares) plotted on PcoA using a distance matrix derived from weighted unifrac clustered significantly differently from baseline (PERMANOVA p=0.001, test statistic=17.475, 999 permutations) while the mice maintained on a chow diet (grey squares) were not significantly different than when at baseline (black circles) (Fig. 19) (PERMANOVA p=0.287, test statistic=1.203, 999 permutations). 58 Figure 20. Relative abundance at the Phylum level at baseline for naïve mice set to receive gavage from either HFD or Chow fed mice. A subset of mice which have elevated abundance of Verrucomicrobia and Proteobacteria stand out and our labeled as the VP+ subgroup. Genetically identical mice have distinct microbiomes at 5 weeks of age. Interestingly, mice bred in identical conditions displayed highly variable abundances of microbes (Fig 20.). A subset of mice, all born in the same litter, displayed a well differentiated microbiome marked by an elevated abundance of Verrucomicrobia and Proteobacteria. 59 Figure 21. Baseline differences in mice prior to gavage plotted on a PcoA using weighted unifrac to generate the underlying distance matrix. Top left cluster is described by several differentially abundant microbes, with the top two being from the families Verrucomicrobia and Proteobacteria phylum When plotting these mice on a PcoA using weighted unifrac distances, two distinct unique clusters formed. The community described in Fig. 20 is also labelled here as the VP+ subgroup (Fig.21). 60 Figure 22. PcoA of Bray Curtis Dissimilarity generated from PICRUSt2 predicted metabolic pathways for gavage recipient mice. VP+ cluster is annotated. We estimated the abundance of metabolic pathways of recipient mice using the PICRUSt2 software package and observed a similar divergent clustering of this subgroup (Fig 22.), indicating that the genomes of VP+ are likely functionally distinct in addition to being phylogenetically distinct. 61 Figure 23. Differentially abundant species of bacteria when comparing subgroups between mice who had an abundance of microbes in the families Verrucomicrobia and Proteobacteria. Using the ANCOM QIIME2 package, we determined the top seven differentially abundant taxa in the VP+ and VP- subgroup, sorting by largest w value (Fig 23.). These 7 taxa were all w>85, well separated from with the next species at w=68. In this package, the w value is the count of times that the null hypothesis (that this specific taxon has the same abundance across the tested groups) is rejected. A large w value means that this specific taxa was very often found to have a differential abundance between samples. The VP+ subgroup was marked by the differential abundance of Akkermansia muciniphila, Parabacteroides distasonis, Clostridium citroniae, and Blautia producta. The VP- subgroup tended to 62 lack all the above, though Lachnospiraceae, a family within Firmicutes, dominated. When comparing the overall abundances in Fig.20, the VP+ subgroup also tended to have a lower abundance of Firmicutes. Figure 24. VP+ Proteobacteria are distinguished by the presence of Enterobacteriaceae and elevated Sutterella spp. Proteobacteria differences are concentrated in the genus Sutterella and in the family Enterobacteriaceae. While the ANCOM analysis above looks at the differential abundance between ASVs in provided subgroups (Fig. 23), it does not consider the evolutionary differences between groups in contrast to a metric like weighted Unifrac, which explains the large distances between VP+/- groups in Fig. 21. When looking at % abundances of just the Proteobacteria phylum, the VP+ subgroup saw a relatively higher abundance of the genus Sutterella, and an unnamed ASV in the family Enterobacteriaceae (Fig. 24). 63 Figure 25. Weighted unifrac PcoA of HFD donors (green squares), recipients (red and blue circles), and chow fed mice (grey squares) for comparison. Similarity prior to gavage in A), one week after the first gavage B), a week after the second gavage C), and a week after the final gavage D). Mice with VP+ microbiota are resistant to exogenous changes from gavage. VP+ and VP- mice were gavaged three times from a subset of HFD fed donors described in Fig.18. Donors overemphasized Firmicutes and clustered in the top and right of PC1 and PC2 of Figure 25 (green squares). The same multidimensional space was used to analyze changes in recipient mice. As discussed above, at baseline, recipient mice formed two unique clusters corresponding primarily to presence or absence of Verrucomicrobia and Proteobacteria, VP+ and VP- respectively (Fig. 25 A red and blue circles). After 64 0.05 ✱✱✱ns ✱✱ ns ns ns 0.00 -0.05 -0.10 VP- VP+ -0.15 e 1 e 2 3 ag g g e av a a av av G G G Figure 26. VP+ Subgroup is resistant to changes induced by gavage with HFD donor ceca, compared to the VP- subgroup which is resistant after gavage three, but shows movement toward donors after the first two gavages. Distances from individual mice in each subgroup were compared to HFD donors at baseline, and then after each first gavage. We then subtracted the distances of each subsequent points to generate a ‘change in distance toward donor’ metric. the first gavage, VP- mice moved toward their donors (Fig 25 B. Toward green squares), while VP+ mice did not. These distance changes were quantified in Fig. 26 by taking the average distance of each recipient at baseline from all of the donors and then quantifying the change in that distance after each gavage. A change greater than 0 indicates a move away from the donor microbiome, while a change less than 0 indicates a change which reduces this distance, i.e. begins to more closely approximate that of the donor microbiome. For each timepoint, VP+ mice had nonsignificant changes versus donors, whereas VP- mice moved toward donors significantly after the first and second gavage. 65 Change in distance from donor Figure 27. Weighted unifrac PcoA of HFD fed mice (green squares), chow donors (grey squares) and recipient mice (black circles). Similarity prior to gavage in A), one week after the first gavage B), a week after the second gavage C), and a week after the final gavage. VP+ Mice gavaged with fecal samples from chow donors are also resistant after initial gavage. However, they move toward donors after the second gavage. Low n in this group make comparisons difficult. VP+ mice gavaged with cecal contents from chow fed mice also displayed initial resistance toward shifts in their microbiota (Fig 27. B). While they received gavages from ceacal contents of mice that were maintained on chow for 12 weeks, the recipient mice were also eating a chow only diet. Therefore, shifts toward chow donors (grey squares) cannot be adequately explained with this experimental setup. 66 Analysis of gavage for explicit maternal influence As the VP+ group described herein were birthed from a single litter, we re-analyzed the data by sub segmenting not by VP status, but by mothers (Fig. 28). Figure 28. Weighted unifrac PcoA of HFD donors (green squares), and recipients colored by their mother/litter (hunter green, pink, purple), and chow fed mice (grey squares) used as a proxy for ‘diet’. All mice are displayed at baseline prior to any gavages to indicate the initial distances that are subtracted out to calculate baseline. 67 Figure 29. VP+ Subgroup (mother B) is resistant to changes induced by gavage with HFD donor ceca, compared to the VP- subgroup(s) of mother A and C, which are amenable to the first gavage. * indicated P<0.05 using a one sample T- Test versus 0. When categorizing by mother and interrogating the impact of gavage (Fig.29), mother B (the VP+ group) remains the only group resistant to all gavages. The other groups are susceptible to change after gavage 1, but resistant after subsequent inducements. 68 Figure 30. Relative abundance of Phyla level microbes, organized by mother. Maternal effect had an impact on the relative abundance of microbes in each litter. Notably, when merely observing the relative abundance data, Verrucomicrobia and Proteobacteria are overrepresented in offspring of Mother B, Actinobacteria in Mother C, and neither of these in Mother A (Fig. 30). 69 Figure 31. Faiths Phylogenetic Diversity of litters organized by mother. Mother B scientifically different vs. C, and approaching significance vs. Mother A. The overall diversity of each of group was described using Faiths Phylogenetic diversity and compared between groups (Fig.31). Mother B is the only group with a significant difference in diversity on this metric, however, this litter had the lowest overall diversity compared to the other groups, with mother C having the greatest overall diversity. 70 Figure 32. HFD gavaged mice categorized by mother plotted against their change toward or away from mice on a chow diet for 12 weeks. One sample T- Test versus 0 was used to determine if the microbiome changed from baseline. *=p<0.05 **=p<0.01 ***=p<0.001 Mice resistant to gavage move significantly toward a proxy of chow diet. We used the microbiomes of mice fed a chow diet for 20 weeks as a proxy for the effect of diet on shifting the microbiome of gavaged mice. As the mice were undergoing gavage treatments, they were maintained on chow and therefore may have been affected by that diet which is high in fermentable carbohydrates. Mice from mother B moved significantly toward the diet proxy at each time point, with mice from mother C moving after gavage 2 and 3. 71 Discussion We sequenced the gut microbes from seemingly near-identical, littermate mice, and found a notable divergence in microbiomes, with some mice displaying a unique phenotype, primarily harboring Verrucomicrobia and Parabacteroides (VP+). Further, the subgroup was also well separated (Fig. 22) on a Bray Curtis Dissimilarity PcoA built off PICRUst2 reporting of metabolic pathway abundances. This software package uses the relative abundance data of microbes to predict which genes are present in the sampled population. Using HFD feeding, we altered donor mice microbiomes, making changes consistent with literature 180195196, although these changes may not replicate completely in humans197,and gavaged their cecal contents into naïve mice, maintained on chow. Post gavage, we found the VP+ recipient subgroup resisted changes toward these exogenous microbes. This subset of mice were born in the same litter and thus likely acquired their microbiome from their mother or early living environment. This distinct microbiome, while changing slightly during our study window, maintained a unique cluster versus other mice when challenged with divergent exogenous microbiota. Exogenous colonization. To establish and test the function of singular microbes in animals, it is common to introduce them via FMT in mice raised in germ free (GF) environments. However, these mice display unique immunopathology’s due to this method of breeding198–200 and access to these models remains limited. Antibiotic treatment followed by colonization has also been employed successfully201–203, although antibiotics alone induce their own phenotype176. Barba et al. transferred microbes three times, three weeks apart, without the use of antibiotics in a C57 model of kidney failure204. These transfers were able to significantly alter the microbiome of recipients toward control, indicating that transfer is possible in the absence of antibiotics. Here we chose to adopt a similar protocol, and choose not to use antibiotics to remove commensals, which might closer mimic a more typical wild-type process of colonization. Wrzosek et al. used polyethylene glycol (PEG) to ‘cleanse’ the bowels of recipient mice prior to various strategies of FMT205. They found that even in the mildest transfer condition (a single human FMT into 72 mice), donor OTUs were found 4 weeks later. These studies used gavages from rodents of one species into another, allowing them to track specific species associated OTUs. In our study, donor and recipient mice were genetically identical and therefore we relied on changes in community structure to determine dissimilarity. In VP+ mice receiving gavages from HFD fed mice, there were no time points post FMT where a movement toward these donors indicated an increase in community similarity. Finally, Freitag et al. directly tested FMT with and without antibiotics from Balb/c to C57BL/6 mice. They found donor transfer was effective with or without antibiotics with a single gavage at week 0 and an 8-week endpoint. In our work, some, though not all, of the VP- mice were more similar to donors at our endpoint than they started, as would be predicted from the literature. However, none of the VP+ mice made any significant movement towards the donor phenotype, indicating that sequencing, isolating and excluding such mice from future studies of FMT without antibiotics may be essential to the transfer’s success. VP- were in general more susceptible to changes in their microbial ecology than VP+ mice. Maldonado- Gόmez et al. studied the predictors of persistence of a B.longum spp in adult humans in 2016, finding that a subset of subjects had B. Longum persisting for 200 days after initial treatment206. The authors find that establishment was best correlated to specific traits or genes, noting that the absence of these allowed these specific B. Longum spp. to fill a niche. Other work by Li et al. found that FMT success, defined by longer term persistence of donor strains in recipients, was correlated to the presence of the donor species, but not the donor strain207. While we lack strain level resolution, VP- mice were more similar to donors than VP+ mice in our study, with an average of 0.26 vs 0.32 units in weighted unifrac distance matrix multidimensional space. Interestingly Parabacteroides distasonis, observed in this study, was among the top 5 strains found in resistant recipient microbiomes found by Li et al. above. It is likely that a complicated dynamic exists between the recipient microbial community, the composition of the donors microbiome, the existence of a niche` to be exploited in the recipient, and the recipients immune system. Further, the presence of unique combinations of microbes may exist with specific colonization resistant traits which inhibit engraftment of a donors microbiome. 73 Colonization resistance. Here we show VP+ commensals inhibiting colonization from donors. This ‘colonization resistance’(CR) is a known phenomenon, with several mechanisms including nutrient competition, direct bacteriocin defense, and colonization of the mucous layer (reviewed in detail by Ducarmon et al.208). Pathogenic bacteria can utilize an altered immune system to overwhelm commensals, as reported by Stecher et al. in 2007209. The authors showed that commensals outcompeted a pathogenic Salmonella but were themselves outcompeted after inflammation was induced via other microbes or by pro-inflammatory T-Cells. A highly differentially abundant species in the VP+ group was Akkermansia muciniphila (Am) (Fig. 23), a mucin degrading microbe210 adhering to enterocytes211 in the mucous layer of the gut, which serves as a barrier between the foreign contents of the lumen, and the endothelial cells making up the human intenstine210. A decrease in barrier thickness is implicated is several diseases associated with insulin sensitivity and inflammation27. It is theorized that a thinner mucous membrane brings potentially pathogenic bacteria into closer contact with the endothelial lining, leading to activation of the innate immune system, and TNF-α elevation. Several commensal bacteria inhabit this mucous layer, with Akkermansia muciniphila being a major resident, compromising 1-4% of our total gut composition210,212 . Further work on this species indicates an inverse relationship between its abundance and several measures of metabolic health, including weight gain, gut barrier function, and inflammation 213,214. Additionally, dietary interventions aimed at improving metabolic health, and diabetes treatments like metformin have been shown to associate with Akkermansia abundance215. Less is known about Parabacteroides distasonis (Pd), with a general search on Google scholar listing 1,750 results since 2017 versus Akkermanisa muciniphila at 9,560 (authors search in April 2021). However, recent work implicates this commensal as associated with health. In 2018, Wang et al. carried out a detailed study administering live or heat killed Pd into DIO or genetically obese mice and tracking metabolic outcomes. Among other outcomes, Pd decreased weight gain and hepatic steatosis, through a mechanism associated with secondary bile acids216. Recent work by Koh et al. in a mouse model of colorectal cancer showed administration of freeze dried Pd could attenuate inflammation (↓IL-4, 74 ↓TNFα,↑IL-10,↑TGF-β, by qPCR) and its associated tumorogensis217. The authors also observed an increase in gut barrier associated gene expression (ZO-1). A recent study in humans by Deehan et al. looked at the impact of different types of resistant starch on the microbiome and its associated metabolites. They found a significant increase in Pd in humans fed tapioca starch, which was associated with an increase in the SCFA propionate, in a dose-dependent manner218. As described earlier, propionate is itself associated with anti-inflammatory effects (↑gut barrier219,↓IL8220), though many of these studies are in-vitro or in mice, with mild benefits in humans. Further, butyrate221 may also be the component driving many of these effects, in contrast to propionate. Future work should focus on uncovering the mechanisms associated with these changes, but along with Am, Pd tends to be identified in the literature as a health-associated commensal. A strikingly relevant study by Caballero et al. in 2017 identified Pd as associated with a group of commensals which exhibited colonization resistance toward Enterococcus faecium (Ef). Here they showed a consortium of commensals including Blautia Producta, another VP+ microbe which we identified, able to repel exogenous colonization with Ef222. While Clostridium citroniae (Cc) is less well studied even than Pd, the same study by Caballero above noted a commensal, Clostridium bolteae (Cb), which along with B. producta is part of the group conferring colonization resistance. Cb and Cc shared 98% sequence homology and were, until 2006, part of the same group223. Therefore, our finding here may be in accord with Caballero’s vis a vis a group of commensals conferring colonization resistance. We also showed a relatively increased abundance of Sutterella spp (Ss). In VP+ mice (Fig 24.). There is evidence of some Sutterella spp, particularly Sutterella wadsworthensis (Sw). being associated with inflammatory diseases like Crohn’s disease (CD)224, and in children with autism225. However, other investigations show no difference in Sw prevalence versus controls in IBD226. A recent report in 2020 by Kaakoush suggested a role for Ss in inhibiting successful FMT’s227 from earlier results from the group. Specifically, Paramsothy et al. in 2019 investigated the association between remission and lack thereof in 75 in-patients receiving FMT for Ulcerative colitis with specific microbes. They found Sutterella associated with lack of remission.228 In that report, Kaakoush also referenced a study by Moon et al in 2015 which associated Ss with a population of microbes able to degrade IgA in B6 mice229. IgA production from the host might be hypothesized to be associated with a stable commensal microbiome, and therefore its degradation would allow for opportunistic colonization by FMT. In our work here, it’s possible that IgA degradation is allowing for the colonization and proliferation of other commensals which themselves contribute to colonization resistance. This may be a role for the Enterobacteriaceae spp. associated with increase Ss (Fig.27). Recent work in 2020 by Wang et al found Ss increased in rats after bariatric surgery with a concomitant increase in Enterobacteriaceae spp230. It’s unclear which specific Enterobacteria are enriched in these samples, as this species is difficult to identify solely using 16S rRNA gene sequencing of the V4 region as we did here231. IgA degradation described above is one of several examples of host immune and microbiome crosstalk. Microbes living symbiotically in the intestinal tract of another organism are in constant contact and communication with their hosts immune system, starting at, or before birth. While there is controversy over the microbial sterility of the placenta232233, there is consensus that stable colonization is a result of an immune – microbial partnership234235. Mazmanian et al. in 2005 showed that a molecule, “polysaccharide A (PSA)” produced by Bacteroides fragilis could correct an imbalanced immune response in germ-free mice236, showing the benefits of this crosstalk. Work by Han et al. in 2013 which ablated the expression of a signaling molecule (TRAF-6) in dendritic cells (DCs) which sample the gut, showed a loss of tolerance, with increased markers of enteritis in the small intestine237. A key mediator of microbial tolerance is immunoglobulin A (IgA), the most abundant Ig in mammals, and induced by the introduction of commensals to GF mice238. Work by Lindner et al. in 2012 pointed to the existence of IgA memory cells239 which might explain the initial toleration and persistence of a select group of commensals (reviewed240). In addition to IgA, Regulatory T cells (Foxp3+, CD4+) also appear after intestinal colonization of commensals241. Lawson et al in 2011 introduced a synthetic microbiome of non- pathogenic commensals into GF mice and measured the distribution of Tregs, finding that colonization of 76 microbes is ‘essential’ for immune homeostasis242. Without commensals, the immune response did not include Tregs and developed an activated effector response. It is therefore not surprising that an offspring’s mother has a significant impact on their progeny’s microbiome. Maternal influence on initial microbiota. This maternal impact on the heterogeneity of gut communities on offspring is well known, being reported by Ley in 2005180. Schloss et al. in 2012 collected fecal samples from C57 BL/6 mice for a year post weaning243, suggesting that communities stabilize 20 days post weaning, showing little change up to a year later. Hansen et al. found that exogenous colonization at 3-weeks of age was particularly stable244, suggesting immunomodulation as a cause. Mice in our study received their first gavage at age 5 weeks, seven days post weaning. We chose this time point as we expected the communities to be more amenable to change at this younger age, versus adult mice, 20 days post weaning according to Schloss, with more stable and therefore imperturbable microbiomes. While we discuss at length the impact of gavage on microbiome change, it should be emphasized that during the entire period of gavaging, these mice are maintained on a chow diet. This diet is a good source of soluble and insoluble fiber and is likely exerting its own effect. To test this, we performed the same distance measurements as described in Ch.3, but used 20-week old mice maintained on chow for 12 weeks (Fig. 28 grey square). as proxies for the effect of chow diet on the microbiome (Fig.32). In stark contrast to changes induced by gavage, the Mother B group changed significantly toward the proxy of diet at each time point. This was not the case for Mother A or C mice. Mother A mice never significantly moved toward diet, while Mother C mice did at later time points. We should note that as we are measuring change from baseline, mice that were already more similar to mice on chow (Mother A and Mother C) have less distance to travel (Fig.28). There may also be an age effect on the microbiome, as the proxy for chow mice are 20 weeks old, versus these mice at gavage 3 who are 8 weeks old. Therefore, using ‘chow donor’ as a proxy is useful, but not a completely sufficient method for explaining the impact of diet. 77 We also analyzed overall phylogenetic diversity of each litter using Faiths Phylogenetic diversity (Fig.31). This metric sums the distances of all branch lengths in a sample. The more diverse the sample, the more branches and therefore the higher the numbers. When comparing overall diversity to data on resistance to gavage, in this case, the lack of diversity in mother B was more predicative of resistance to colonization. However, the intermediate diversity level of mother A, a group that was most susceptible to colonization, casts doubt on this metric on its own as an indicator of colonization resistance. When sub-categorizing mice by their mothers, similar trends that we described using VP+/- measures held. However, when we looked the effect of diet, using mice on chow for 12 weeks as a proxy, we did see a differential impact by mother. Further, mice who were resistant to any change by HFD gavage were very susceptible to change by diet, indicating that even this microbiome is not static. Future work should continue to explore the impact of pre and probiotics on the microbiome, as this work indicates that prebiotics may be more impactful. Conclusions Here we show a subset of commensal microbes which resist acute changes from exogenous microbes. These commensals are associated with mice born of the same mother and mirror a similar group with unique properties reported in literature. This work gives support for communities of microbes which co- occur to create emergent phenotypes. Remarks and future direction While it is tempting and useful to study single microbes and their functions independently, this work underscores the importance of looking at the community as a whole. The interaction between microbes, their environment, what they metabolize, excrete, and how they support or inhibit each other is a complex milieu. Deeper study of these complex communities will improve our ability to fight pathogens, improve gut and immune health, and may yield insights which allow for the creation of novel therapeutics. 78 79 80 Appendix Introduction Mice from Ch.2 who underwent treatment with 10% Inulin had unique changes to their microbiome which are analyzed and discussed herein. Initially, this was among a list of treatments taken to induce the growth of Akkermansia, and therefore these other treatments will also be discussed. Microbiome analysis of 10% Inulin mice from Ch. 1 HFD Inulin Guts 1.0 0.8 k__Bacteria;p__Cyanobacteria k__Bacteria;p__ 0.6 k__Bacteria;__ k__Bacteria;p__TM7 k__Bacteria;p__Tenericutes 0.4 k__Bacteria;p__Actinobacteria k__Bacteria;p__Proteobacteria k__Bacteria;p__Verrucomicrobia 0.2 k__Bacteria;p__Bacteroidetes k__Bacteria;p__Firmicutes 0.0 1 2 3 4 5 6 7 8 9 10 11 12 13 Mice Chow Inulin Guts 1.0 0.8 k__Bacteria;p__Cyanobacteria k__Bacteria;p__ 0.6 k__Bacteria;__ k__Bacteria;p__TM7 k__Bacteria;p__Tenericutes 0.4 k__Bacteria;p__Actinobacteria k__Bacteria;p__Proteobacteria k__Bacteria;p__Verrucomicrobia 0.2 k__Bacteria;p__Bacteroidetes k__Bacteria;p__Firmicutes 0.0 1 2 3 4 5 6 7 8 9 Mice Figure 33. C57 Bl/6 mice on HFD or Chow supplemented with 10% Inulin for 8 weeks. 81 Relative Abundance Relative Abundance C57 Bl/6 mice from Ch.1 that were fed Chow or HFD + Inulin for 8 weeks had their microbiomes sequenced and analyzed as reported in Ch.2 (Fig.33). Here we intended to increase Akkermansia muciniphila in order to protect from certain metabolic and taste dysfunction, as outlined in Ch.1. Figure 34. Differentially abundant species of bacteria elevated in mice fed HFD + 10% Inulin for 8 weeks. HFD + Inulin did increase Akkermansia, along with Sutterella and Bifidobacterium as compared with other treatments (Fig 34). 82 Figure 35. Differentially abundant species of bacteria elevated in mice fed HFD for 12 weeks versus mice fed Chow for 12 weeks, or HFD / Chow supplemented with 10% Inulin for 10 weeks/ When compared to mice on HFD alone for 12 weeks HFD + Inulin mice have significantly less of the phylum Firmicutes, specifically Lactococcus and ‘Clostridium’ from Erysipelotrichaceae, and Clostridiaceae families (Fig. 35). It should be noted that Chow + Inulin was much less effective at inducing Akkermansia versus HFD + Inulin (Fig.33). It is likely that a high fiber environment, as in chow feeding, provides a stable niche for the Bacteroidetes phylum, which resists the expansion of Akkermansia, even in the presence of Inulin. However, in the context of HFD, they lose fitness versus Firmicutes, opening a niche for Akkermansia to expand in the presence of Inulin. 83 Akkermansia Induction via Berberine Per the report of Roopchand et al. in 2015, we intended to use Berberine to induce the growth of Akkermansia in our mice245. At 0.5g Berberine /L H2O, mice did not prefer it versus water (Fig.31). Figure 36. Two bottle preference test of H2O vs 0.5g/L Berberine in H2O. We evaluated these mice for presence of Akkermansia by qPCR, never detecting the microbe despite 8 weeks of Berberine treatment. 84 Figure 37. qPCR on DNA extracted from fecal samples of mice maintained on Inulin for two weeks (Left). Then maintained on Inulin and co-housed with feces from positive mouse over 7 weeks (right). Each color represents a different sample. Samples were run in duplicate, so each color has two points. Mice are in the far-left column, positive control sequence in center, and non-template control on right. Primers were adapted from Roopchand et al. “AM1: 5’-CAGCACGTGAAGGTGGGGAC-3’; AM2: 5’-CCTTGCGG TTGGCTTCAGAT-3’)”, amplification protocol was determined experimentally and is described in the appendix. Akkermansia Induction via Inulin and Coprophagia The above 4 mice were then switched to eating 10% Inulin in their chow and after two weeks, one was positive for Akkermansia. We used fecal droppings from that cage to induce Akkermansia in the remaining mice, achieving Akkermansia induction in all four 5 weeks later (Fig. 36). 85 Gavage effects on taste behavior in mice from Ch. 3 Mice from the gavage experiments in Ch.2. were also assayed for taste behavior as in the groups from Ch.1. However, analysis revealed that the gavage itself seemed to have a negative impact on Lickometer testing, causing a majority of mice to fail a quality control (QC) check prior to stimulus testing. A mouse will pass QC if it licks 1M sucrose more than water. In the groups receiving gavages, 4 of 7 mice receiving gavage from chow mice failed, 8 of 14 from HFD mice failed, and 3 of 8 receiving a control PBS/Glycerol mix failed. Typically, 90% of mice will pass this test. We were able to complete a two-bottle sucrose preference test (Fig. 37) and saw no impact on sucrose preference from either donor. Figure 38. Two bottle sucrose preference test (0.025M sucrose) on mice receiving gavages from either HFD or Chow fed mice for 12 weeks. 86 Figure 39. MPO positivity across all groups, with the gavage groups in the last two columns from right. We suspected increased inflammation or injury due to the trauma of repeated gavage as a cause for an increase in mice failing to complete the lickometer tasks. To that end, we sectioned their tongues and stained for MPO, as described throughout this document, as an indicator of inflammation. We found no difference in MPO positivity between mice receiving gavage from HFD versus chow, nor between mice who received gavages versus mice maintained on various diets. Comparisons are complicated due to the younger age of these mice, but acute inflammation did not seem to be a factor, at least as measured by elevated MPO in the CV of taste buds (Fig. 38). However, the gavage needle is engineered as to not damage any lingual surfaces, and any acute inflammation would therefore be more likely to occur in the esophagus or further down the gastrointestinal tract. 87 Figure 40. Total liquid intake in a two bottle test of mice on Chow, HFD (12w) and mice receiving cecal contents from Chow and HFD mice via gavage. Liquid intake is sucrose + H2O. We did not detect a difference in total liquid intake through two-bottle testing, which might have indicated a more general esophageal damage to the animals (Fig. 39). It should be noted that the two bottle tests occurred ~7-10 days after lickometer and behavioral testing and could therefore miss any acute damage sustained during gavage. Conclusions and remarks Inducing the growth of Akkermansia was not as straightforward as adding Inulin. As shown in figure 28, Inulin alone was not sufficient to up regulate Akkermansia in all subjects when mixed with the chow diet, yet it was sufficient when mixed with High Fat Diet. These mice did not receive fecal transplants or coprophagia, yet Akkermansia did develop. It is possible that the microbes were introduced through contaminated HFD, as this diet is not irradiated or autoclaved prior to use. However, in mice fed HFD without Inulin for 12 months, we generally see a reduction in Akkermansia abundance. HFD is likely working to clear away commensals, perhaps in the Bacteroidetes Phylum, that would otherwise compete with Akkermansia, allowing it to thrive in a high Inulin niche. Even with high inulin, this is not enough to make Akkermansia completely competitive in an the otherwise adequate fiber environment as shown in the Inulin Chow mice. 88 Miscellaneous reagent compositions and technical information Reagents: Normal Tyrode’s 135 mM NaCl 5 mM KCl 2 mM CaCl2 1 mM MgCl 5 mM NaHCO3 10 mM HEPES 10 mM Glucose 10 mM Sodium Pyruvate pH 7.4 Ca2+ Free Tyrode’s 135 mM NaCl 5 mM KCl 20mM EGTA 10 mM HEPES 5 mM BAPTA (1,2-Bis (2-aminophenoxy) ethane-N, N, N, N-tetraacetic acid tetrapotassium salt) 10 mM Glucose 10 mM Sodium Pyruvate pH 7.4 Enzyme cocktail In Normal Tyrode’s solution Dispase II 2.5 mg/ml Collagenase A 1mg/ml Elastase 0.25 mg/ml DNaseI 0.5mg/ml Methods Real time Akkermansia tracking via qPCR. Fecal samples were processed into DNA as described above via PowerFecal DNA isolation kit (MO BIO laboratories Inc, Carlsbad CA). Primers for the qPCR reaction were as follows, F, 5’->3’ (CAGCACGTGAAGGTGGGGAC), R (CCTTGCGGTTGGCTTCAGAT). qPCR was performed as described in the supplemental protocol section that follows this manuscript. 89 TNFα ELISA. Serum collection Mice were euthanized with CO2 followed by cervical dislocation, following protocols approved by Cornell CARE (Center for Animal Resources and Education) and IACUC (Institutional Animal Care and Use Committee). Immediately after euthanizing, mice were dissected longitudinally, revealing the abdominal cavity and visualizing the abdominal aorta. A 30-gauge needle was inserted into the artery and ~300 µL of arterial blood was collected in non-heparanized Eppendorf tubes. The blot was left to clot for 1hr at room temperature before being centrifuged at 3000g at 4 C for 15 minutes to separate serum from blood. Serum collected from the supernatant was immediately frozen and stored at -80 C for later analysis. Induction of Akkermansia: We first attempted to induce Akk by supplementing drinking water with 0.5 g/L Berberine chloride hydrate. According to the literature, berberine boosts Akkermansia growth after a 12 week treatment from ~0% to 8-13%246. Mice began Berberine treatment immediately after being single housed at 4 weeks of age, with high fat diet starting at 8 weeks and continuing for 12 weeks, as in Aim 1. We intended to test mice both consuming berberine throughout dietary treatment, and with berberine treatment suspended after Akk positivity is conferred, to deconvolute any downstream drug effects. However, Akk abundance was not increased in our animals (However, Akkermansia was successfully induced by supplementing with 10% Inulin and coprophagia from already positive mice) Berberine. Berberine, an alkaloid found in foods such as turmeric, has long been employed as a traditional remedy in China. More recently, berberine has been investigated as a treatment for several metabolic diseases, in lowering cholesterol levels, alleviating inflammation, and ameliorating symptoms of insulin resistance247–249. A more recent study on the mechanism of Berberine activity suggests that it exerts these effects by increasing the abundance of Akkermansia in the gut of the host246. This increase 90 leads to the multiple downstream effects listed above, with authors positing the effects are due to increases in butyrate production in the gut. We treated mice with Berberine to encourage the expansion of Akkermansia in mice fed either a control or a HFD, which we predicted would attenuate its downstream effects and protect mice from taste damage. This was not successful. Primers and PCR: qPCR amplification of Akkermansia 1. 95°C 10 minutes 2. 95°C 15 seconds 3. 66°C 60 seconds (Fluorescence reading ongoing at this step) 4. Repeat steps 2-3 40 times Akkermansia primers from Roopchand et al.245 AM1: 5’-CAGCACGTGAAGGTGGGGAC-3’ AM2: 5’-CCTTGCGG TTGGCTTCAGAT-3’ qPCR amplification of 16S rRNA to determine total microbial amount 1. 95°C 10 minutes 2. 95°C 15 seconds 3. 50°C 40 seconds 4. 72°C 30 seconds 5. Repeat steps 2-4 40 times qPCR amplification of cDNA for taste and gut gene expression 1. 95°C 10 minutes 2. 95°C 15 seconds 3. 60°C 60 seconds 4. Repeat steps 2-3 40 times 91 References 1. Mccrickerd, K. & Forde, C. G. Sensory influences on food intake control: Moving beyond palatability. Obes. Rev. 17, 18–29 (2016). 2. Martinez, J. A. Body-weight regulation : causes of obesity. 337–345 (2021). 3. Jeffery, R. W. & Harnack, L. J. Evidence implicating eating as a primary driver for the obesity epidemic. Diabetes 56, 2673–2676 (2007). 4. Wright, S. M. & Aronne, L. J. Causes of obesity. Abdom. Imaging 37, 730–732 (2012). 5. Caballero, B. The global epidemic of obesity: An overview. Epidemiol. Rev. 29, 1–5 (2007). 6. Drewnowski, A. Taste Preferences and Food Intake. Annu. Rev. Nutr. 17, 237–253 (1997). 7. Nasser, J. Taste, food intake and obesity. Obes. Rev. 2, 213–218 (2001). 8. Han, P., Bagenna, B. & Fu, M. The sweet taste signalling pathways in the oral cavity and the gastrointestinal tract affect human appetite and food intake: a review. Int. J. Food Sci. Nutr. 70, 125–135 (2019). 9. Cohn, Z. J., Kim, A., Huang, L., Brand, J. & Wang, H. Lipopolysaccharide-induced inflammation attenuates taste progenitor cell proliferation and shortens the life span of taste bud cells. BMC Neurosci. 11, 9–14 (2010). 10. Yang, H., Cong, W. na, Yoon, J. S. & Egan, J. M. Vismodegib, an antagonist of hedgehog signaling, directly alters taste molecular signaling in taste buds. Cancer Med. 4, 245–252 (2015). 11. Mukherjee, N., Pal Choudhuri, S., Delay, R. J. & Delay, E. R. Cellular mechanisms of cyclophosphamide-induced taste loss in mice. PLoS One 12, 1–23 (2017). 12. Kumarhia, D., He, L. & McCluskey, L. P. Inflammatory stimuli acutely modulate peripheral taste function. J. Neurophysiol. 115, 2964–2975 (2016). 13. Kaufman, A., Choo, E., Koh, A. & Dando, R. Inflammation arising from obesity reduces taste bud abundance and inhibits renewal. PLoS Biol. 16, 1–14 (2018). 14. Kaufman, A., Kim, J., Noel, C. & Dando, R. Taste loss with obesity in mice and men. Int. J. Obes. 44, 739–743 (2020). 15. Wellen, K. E. & Hotamisligil, G. S. Inflammation, stress, and diabetes. J. Clin. Invest. 115, (2005). 16. Gregor, M. F. & Hotamisligil, G. S. Inflammatory Mechanisms in Obesity. Annu. Rev. Immunol. 29, 415–445 (2011). 17. Zeevi, D. et al. Personalized Nutrition by Prediction of Glycemic Responses. Cell 163, 1079–1095 (2015). 18. Hussain, S. S. & Bloom, S. R. The regulation of food intake by the gut-brain axis: implications for obesity. Int. J. Obes. 37, 625–633 (2012). 19. Shigemura, N. et al. Leptin Modulates Behavioral Responses to Sweet Substances by Influencing Peripheral Taste Structures. Endocrinology 145, 839–847 (2004). 20. Goodrich, J. K. et al. Genetic Determinants of the Gut Microbiome in UK Twins Correspondence. Cell Host Microbe 19, 731–743 (2016). 21. Donaldson, L. F., Bennett, L., Baic, S. & Melichar, J. K. Taste and weight: Is there a link? Am. J. Clin. Nutr. 90, 800–803 (2009). 22. Drewnowski, A., Brunzell, J. D., Sande, K., Iverius, P. H. & Greenwood, M. R. C. Sweet tooth reconsidered: Taste responsiveness in human obesity. Physiol. Behav. 35, 617–622 (1985). 23. Bernard, A., Ancel, D. & Neyrinck, A. M. A Preventive Prebiotic Supplementation Improves the Sweet Taste Perception in Diet-Induced Obese Mice. (2019). doi:10.3390/nu11030549 24. Carabotti, M., Scirocco, A., Maselli, M. A. & Severi, C. The gut-brain axis: Interactions between enteric microbiota, central and enteric nervous systems. Ann. Gastroenterol. 28, 203–209 (2015). 25. Clemente, J. C., Ursell, L. K., Parfrey, L. W. & Knight, R. The impact of the gut microbiota on human health: An integrative view. Cell 148, 1258–1270 (2012). 26. Bezen??on, C., le Coutre, J. & Damak, S. Taste-signaling proteins are coexpressed in solitary intestinal epithelial cells. Chem. Senses 32, 41–49 (2007). 92 27. Cani, P. D. et al. Metabolic Endotoxemia Initiates Obesity and Insulin Resistance. doi:10.2337/db06-1491 28. Zhu, X., He, L. & Mccluskey, A. L. P. Ingestion of bacterial lipopolysaccharide inhibits peripheral taste responses to sucrose in mice. Neuroscience 258, 47–61 (2014). 29. Cohn, Z. J., Kim, A., Huang, L., Brand, J. & Wang, H. Lipopolysaccharide-induced inflammation attenuates taste progenitor cell proliferation and shortens the life span of taste bud cells. BMC Neurosci. 11, 72 (2010). 30. Goodman, J. R. & Dando, R. To Detect and Reject, Parallel Roles for Taste and Immunity. Curr. Nutr. Rep. 137–145 (2021). doi:10.1007/s13668-021-00355-3 31. Boscolo-Rizzo, P. et al. Evolution of Altered Sense of Smell or Taste in Patients with Mildly Symptomatic COVID-19. JAMA Otolaryngol. - Head Neck Surg. 146, 1–5 (2020). 32. Cazzolla, A. P. et al. Taste and smell disorders in COVID-19 patients: Role of interleukin-6. ACS Chem. Neurosci. 11, 2774–2781 (2020). 33. Parma, V. et al. More Than Smell-COVID-19 Is Associated With Severe Impairment of Smell, Taste, and Chemesthesis. Chem. Senses 45, 609–622 (2020). 34. Sukumaran, S. K. et al. Whole transcriptome profiling of taste bud cells. Sci. Rep. 7, 1–15 (2017). 35. Archer, N. et al. Obesity is associated with altered gene expression in human tastebuds. Int. J. Obes. 43, 1475–1484 (2019). 36. Medzhitov, R. Origin and physiological roles of inflammation. Nature 454, 428–435 (2008). 37. S, Gautamethi, Bokyung Sung, B. B. A. [Frontiers in Bioscience 5094-5107, May 1, 2008] TNF: A master switch for inflammation to cancer Gautam Sethi, Bokyung Sung, Bharat B. Aggarwal. Front. Biosci. 5094–5107 (2008). 38. Tanaka, T., Narazaki, M. & Kishimoto, T. IL-6 in Inflammation, Immunity, and Disease. 6, (2014). 39. Marnell, L., Mold, C. & Du Clos, T. W. C-reactive protein: Ligands, receptors and role in inflammation. Clin. Immunol. 117, 104–111 (2005). 40. Christ, A. & Latz, E. The Western lifestyle has lasting effects on metaflammation. Nat. Rev. Immunol. 19, 267–268 (2019). 41. Wang, J. et al. Resistance. (2001). 42. Hotamisligil, G. S. & Erbay, E. Nutrient sensing and inflammation in metabolic diseases. Nat. Rev. Immunol. 8, 923–934 (2008). 43. Myers, M. G., Cowley, M. A. & Münzberg, H. Mechanisms of leptin action and leptin resistance. Annu. Rev. Physiol. 70, 537–556 (2008). 44. Aguliar-Valles, A., Kim, J., Jung, S., Woodside, B. & Luheshi, G. N. Role of brain transmigrating neutrophils in depression-like behavior during systemic infection. Mol. Psychiatry 19, 599–606 (2014). 45. Wang, H., Zhou, M., Brand, J. & Huang, L. Inflammation activates the interferon signaling pathways in taste bud cells. J. Neurosci. 27, 10703–13 (2007). 46. Feng, P., Zhao, H., Chai, J., Huang, L. & Wang, H. Expression and secretion of TNF-?? in mouse taste buds: A novel function of a specific subset of type II taste cells. PLoS One 7, (2012). 47. Wang, H., Zhou, M., Brand, J. & Huang, L. Inflammation and taste disorders: Mechanisms in taste buds. Ann. N. Y. Acad. Sci. 1170, 596–603 (2009). 48. Feng, P. et al. Regulation of bitter taste responses by tumor necrosis factor. Brain. Behav. Immun. 49, 32–42 (2015). 49. Pittman, D. W. et al. Behavioral and neurophysiological taste responses to sweet and salt are diminished in a model of subclinical intestinal inflammation. Sci. Rep. 10, 1–13 (2020). 50. Djeziri, F. Z. et al. Oleanolic acid improves diet-induced obesity by modulating fat preference and inflammation in mice. Biochimie 152, 110–120 (2018). 51. Zheng, K. et al. Bitter taste receptors as targets for tocolytics in preterm labor therapy. FASEB J. 31, 4037–4052 (2017). 52. Camandola, S. & Mattson, M. P. Toll-like receptor 4 mediates fat, sugar, and umami taste 93 preference and food intake and body weight regulation. Obesity 00, 1–9 (2017). 53. Feng, S., Achoute, L., Margolskee, R. F., Jiang, P. & Wang, H. Lipopolysaccharide-Induced Inflammatory Cytokine Expression in Taste Organoids. Chem. Senses 45, 187–194 (2020). 54. Gomez, F. E., Cassí-Nosthas, L., Morales-de-León, J. C. & Bourges, H. Detection and recognition thresholds to the 4 basic tastes in Mexican patients with primary Sögren’s syndrome. Eur. J. Clin. Nutr. 58, 629–636 (2004). 55. Steinbach, S. et al. Smell and Taste in Inflammatory Bowel Disease. PLoS One 8, (2013). 56. Ballok, D. A., Szechtman, H. & Sakic, B. Taste responsiveness and diet preference in autoimmune MRL mice. Behav. Brain Res. 140, 119–130 (2003). 57. Jonsson, R., Bolstad, A. I., Brokstad, K. A. & Brun, J. G. Sjögren’s syndrome - A plethora of clinical and immunological phenotypes with a complex genetic background. Ann. N. Y. Acad. Sci. 1108, 433–447 (2007). 58. Kim, A. et al. Defects in the peripheral taste structure and function in the MRL/lpr mouse model of autoimmune disease. PLoS One 7, (2012). 59. Kataoka, S. et al. The candidate sour taste receptor, PKD2L1, Is expressed by type III taste cells in the mouse. Chem. Senses 33, 243–254 (2008). 60. Carey, R. M. & Lee, R. J. Taste receptors in upper airway innate immunity. Nutrients 11, 1–17 (2019). 61. Lee, R. J. & Cohen, N. A. Taste receptors in innate immunity. Cell. Mol. Life Sci. 72, 217–236 (2015). 62. Latorre, R. et al. Expression of the Bitter taste receptor, T2R38, in enteroendocrine cells of the colonic mucosa of overweight/obese vs. Lean subjects. PLoS One 11, 1–16 (2016). 63. Kok, B. P. et al. Intestinal bitter taste receptor activation alters hormone secretion and imparts metabolic benefits. Mol. Metab. 16, 76–87 (2018). 64. Howitt, M. R. et al. Tuft cells, taste-chemosensory cells, orchestrate parasite type 2 immunity in the gut. Science (80-. ). 351, 1329–1333 (2016). 65. Liu, S. et al. Members of bitter taste receptor cluster Tas2r143/Tas2r135/Tas2r126 are expressed in the epithelium of murine airways and other non-gustatory tissues. Front. Physiol. 8, 1–17 (2017). 66. Jaggupilli, A. et al. Chemosensory bitter taste receptors (T2Rs) are activated by multiple antibiotics. FASEB J. 33, 501–517 (2019). 67. Deshpande, D. A. et al. Bitter taste receptors on airway smooth muscle bronchodilate by localized calcium signaling and reverse obstruction. Nat. Med. 16, 1299–1304 (2010). 68. Lee, R. J. et al. Bacterial D-amino acids suppress sinonasal innate immunity through sweet taste receptors in solitary chemosensory cells. Sci. Signal. 10, 1–12 (2017). 69. Bassoli, A., Borgonovo, G., Caremoli, F. & Mancuso, G. The taste of D- and L-amino acids: In vitro binding assays with cloned human bitter (TAS2Rs) and sweet (TAS1R2/TAS1R3) receptors. Food Chem. 150, 27–33 (2014). 70. Spotten, L. E. et al. Subjective and objective taste and smell changes in cancer. Ann. Oncol. Off. J. Eur. Soc. Med. Oncol. 28, 969–984 (2017). 71. Murtaza, B., Hichami, A., Khan, A. S., Ghiringhelli, F. & Khan, N. A. Alteration in taste perception in cancer: Causes and strategies of treatment. Front. Physiol. 8, 1–10 (2017). 72. Delay, E. R. et al. Cyclophosphamide and the taste system: Effects of dose fractionation and amifostine on taste cell renewal. PLoS One 14, 1–23 (2019). 73. Schalk, P. et al. Influence of cancer and acute inflammatory disease on taste perception: a clinical pilot study. Support. Care Cancer 26, 843–851 (2018). 74. Lumeng, C. N. & Saltiel, A. R. Review series Adipose tissue remodeling and obesity. J. Clin. Invest. 121, 2111–2117 (2011). 75. Karastergiou, K. & Mohamed-Ali, V. The autocrine and paracrine roles of adipokines. Mol. Cell. Endocrinol. 318, 69–78 (2010). 76. Strissel, K. J. et al. Adipocyte death, adipose tissue remodeling, and obesity complications. 94 Diabetes 56, 2910–2918 (2007). 77. Legein, B., Temmerman, L., Biessen, E. A. L. & Lutgens, E. Inflammation and immune system interactions in atherosclerosis. Cell. Mol. Life Sci. 70, 3847–3869 (2013). 78. Hotamisligil, G. S., Atkinson, R. L. & Spiegelman, B. M. alpha in human obesity and insulin resistance . Obesity and Insulin Resistance. 95, 2409–2415 (1995). 79. Ellulu, M. S. et al. Obesity and Inflammation : The Linking Mechanism and the Complications. Arch. Med. Sci. 851–863 (2016). 80. Den Hertog, H. M. et al. C-reactive protein in the very early phase of acute ischemic stroke: Association with poor outcome and death. J. Neurol. 256, 2003–2008 (2009). 81. Danesh, J. et al. Long-term interleukin-6 levels and subsequent risk of coronary heart disease: Two new prospective studies and a systematic review. PLoS Med. 5, 0600–0610 (2008). 82. Kirchgessner, T. G., Uysal, K. T., Wiesbrock, S. M., Marino, M. W. & Hotamisligil, G. S. Tumor necrosis factor-α contributes to obesity-related hyperleptinemia by regulating leptin release from adipocytes. J. Clin. Invest. 100, 2777–2782 (1997). 83. Uysal, K. T., Wiesbrock, S. M. & Hotamisligil, G. S. Functional analysis of tumor necrosis factor (TNF) receptors in TNF-α- mediated insulin resistance in genetic obesity. Endocrinology 139, 4832–4838 (1998). 84. Zhou, L. et al. Sweet taste receptors mediated ROS-NLRP3 inflammasome signaling activation: Implications for diabetic nephropathy. J. Diabetes Res. 2018, (2018). 85. Pepino, M. Y., Finkbeiner, S., Beauchamp, G. K. & Mennella, J. A. Obese Women Have Lower Monosodium Glutamate Taste Sensitivity and Prefer Higher Concentrations Than Do Normal- weight Women. Obesity 18, 959–965 (2009). 86. Fernandez-Garcia, J. C. et al. An increase in visceral fat is associated with a decrease in the taste and olfactory capacity. PLoS One 12, 1–14 (2017). 87. Hardikar, S., Höchenberger, R., Villringer, A. & Ohla, K. Higher sensitivity to sweet and salty taste in obese compared to lean individuals. Appetite 111, 158–165 (2017). 88. Frijters, J. E. & Rasmussen-Conrad, E. L. Sensory discrimination, intensity perception, and affective judgment of sucrose-sweetness in the overweight. The Journal of general psychology 107, 233–247 (1982). 89. Chao, D. H. M. et al. Impact of obesity on taste receptor expression in extra-oral tissues: Emphasis on hypothalamus and brainstem. Sci. Rep. 6, 1–14 (2016). 90. Noel, C. A., Sugrue, M. & Dando, R. Participants with pharmacologically impaired taste function seek out more intense, higher calorie stimuli. Appetite 117, 74–81 (2017). 91. Hwang, L. D. et al. New insight into human sweet taste: A genome-wide association study of the perception and intake of sweet substances. Am. J. Clin. Nutr. 109, 1724–1737 (2019). 92. Nielsen, M. S. et al. Bariatric Surgery Leads to Short-Term Effects on Sweet Taste Sensitivity and Hedonic Evaluation of Fatty Food Stimuli. Obesity 27, 1796–1804 (2019). 93. Berthoud, H. R. & Zheng, H. Modulation of taste responsiveness and food preference by obesity and weight loss. Physiol. Behav. 107, 527–532 (2012). 94. BURGE, J. C., SCHAUMBURG, J. Z., CHOBAN, P. S., DiSILVESTRO, R. A. & FLANCBAUM, L. Changes in Patients’ Taste Acuity after Roux-en-Y Gastric Bypass for Clinically Severe Obesity. Journal of the American Dietetic Association 95, 666–670 (1995). 95. Green, E., Jacobson, A., Haase, L. & Murphy, C. Reduced nucleus accumbens and caudate nucleus activation to a pleasant taste is associated with obesity in older adults. Brain Res. 1386, 109–117 (2011). 96. Babbs, R. K. et al. Decreased caudate response to milkshake is associated with higher body mass index and greater impulsivity. Physiol. Behav. 121, 103–111 (2013). 97. Bohon, C. Brain response to taste in overweight children: A pilot feasibility study. PLoS One 12, 1–9 (2017). 98. Jones, R. Taste bud regeneration and the search for taste progenitor cells. Bone 23, 1–7 (2014). 99. Perea-Martinez, I., Nagai, T. & Chaudhari, N. Functional Cell Types in Taste Buds Have Distinct 95 Longevities. PLoS One 8, 1–9 (2013). 100. Castillo-Azofeifa, D. et al. Sonic hedgehog from both nerves and epithelium is a key trophic factor for taste bud maintenance. Dev. 144, 3054–3065 (2017). 101. Ahart, Z. C. et al. Differential Effects of Diet and Weight on Taste Responses in Diet-Induced Obese Mice. Obesity 28, 284–292 (2020). 102. Bernard, A. et al. A chronic LPS-induced low-grade inflammation fails to reproduce in lean mice the impairment of preference for oily solution found in diet-induced obese mice. Biochimie 159, 112–121 (2019). 103. Bernard, A. et al. A preventive prebiotic supplementation improves the sweet taste perception in diet-induced obese mice. Nutrients 11, (2019). 104. Feng, P. et al. Aggravated gut inflammation in mice lacking the taste signaling protein α- gustducin. Brain. Behav. Immun. 71, 23–27 (2018). 105. Sharma, P. et al. Bitter Taste Receptor Agonists Mitigate Features of Allergic Asthma in Mice. Sci. Rep. 7, 1–14 (2017). 106. Adappa, N. D. et al. Correlation of T2R38 taste phenotype and in vitro biofilm formation from nonpolypoid chronic rhinosinusitis patients. Int. Forum Allergy Rhinol. 6, 783–791 (2016). 107. Schiffman, S. S. Taste and smell losses in normal aging and disease. J. Am. Med. Assoc. 278, 1357–1362 (1997). 108. Henkin, R. I., Levy, L. M. & Fordyce, A. Taste and smell function in chronic disease:: A review of clinical and biochemical evaluations of taste and smell dysfunction in over 5000 patients at the Taste and Smell Clinic in Washington, DC. Am. J. Otolaryngol. - Head Neck Med. Surg. 34, 477– 489 (2013). 109. Mojet, J., Christ-Hazelhof, E. & Heidema, J. Taste perception with age: Generic or specific losses in threshold sensitivity to the five basic tastes? Chem. Senses 26, 845–860 (2001). 110. Kaneda, H. et al. Decline in taste and odor discrimination abilities with age, and relationship between gustation and olfaction. Chem. Senses 25, 331–337 (2000). 111. Puputti, S., Aisala, H., Hoppu, U. & Sandell, M. Factors explaining individual differences in taste sensitivity and taste modality recognition among Finnish adults. J. Sens. Stud. 34, (2019). 112. Kure Liu, C. et al. Brain Imaging of Taste Perception in Obesity: a Review. Curr. Nutr. Rep. 8, 108–119 (2019). 113. Ahmed, K., Penney, N., Darzi, A. & Purkayastha, S. Taste Changes after Bariatric Surgery: a Systematic Review. Obes. Surg. 28, 3321–3332 (2018). 114. McCluskey, L. P., He, L., Dong, G. & Harris, R. Chronic exposure to liquid sucrose and dry sucrose diet have differential effects on peripheral taste responses in female rats. Appetite 145, 104499 (2020). 115. Sartor, F. et al. Taste perception and implicit attitude toward sweet related to body mass index and soft drink supplementation. Appetite 57, 237–246 (2011). 116. Steen, P. W., Shi, L., He, L. & McCluskey, L. P. Neutrophil responses to injury or inflammation impair peripheral gustatory function. Neuroscience 167, 894–908 (2010). 117. Kumarhia, D., He, L. & McCluskey, L. P. Inflammatory stimuli acutely modulate peripheral taste function. J. Neurophysiol. 115, 2964–2975 (2016). 118. Brown, K., DeCoffe, D., Molcan, E. & Gibson, D. L. Diet-induced dysbiosis of the intestinal microbiota and the effects on immunity and disease. Nutrients 4, 1095–1119 (2012). 119. Bernard, A., Delzenne, N. & Besnard, P. A Preventive Prebiotic Supplementation Improves the. (2019). doi:10.3390/nu11030549 120. Simpson, H. L. & Campbell, B. J. Review article: Dietary fibre-microbiota interactions. Aliment. Pharmacol. Ther. (2015). doi:10.1111/apt.13248 121. Belzer, C. & De Vos, W. M. Microbes insidefrom diversity to function: The case of Akkermansia. ISME J. 6, 1449–1458 (2012). 122. Nijhuis, J. et al. Neutrophil activation in morbid obesity, chronic activation of acute inflammation. Obesity 17, 2014–2018 (2009). 96 123. Talukdar, S. et al. Neutrophils mediate insulin resistance in mice fed a high-fat diet through secreted elastase. Nat. Med. 18, 1407–1412 (2012). 124. Suez, J. et al. Artificial sweeteners induce glucose intolerance by altering the gut microbiota. Nature 514, 181–186 (2014). 125. Gil-Cardoso, K. et al. A cafeteria diet triggers intestinal inflammation and oxidative stress in obese rats. Br. J. Nutr. 117, 218–229 (2017). 126. Glendinning, J. I., Gresack, J. & Spector, A. C. A high-throughput screening procedure for identifying mice with aberrant taste and oromotor function. Chem. Senses 27, 461–474 (2002). 127. Moller, D. E. Potential role of TNF-α in the pathogenesis of insulin resistance and type 2 diabetes. Trends Endocrinol. Metab. 11, 212–217 (2000). 128. Pepino, M. Y. & Mennella, J. A. Habituation to the pleasure elicited by sweetness in lean and obese women. Appetite 58, 800–805 (2012). 129. Naneix, F., Darlot, F., Coutureau, E. & Cador, M. Long-lasting deficits in hedonic and nucleus accumbens reactivity to sweet rewards by sugar overconsumption during adolescence. Eur. J. Neurosci. 43, 671–680 (2016). 130. Weiss, M. S., Hajnal, A., Czaja, K. & Di Lorenzo, P. M. Taste Responses in the Nucleus of the Solitary Tract of Awake Obese Rats Are Blunted Compared With Those in Lean Rats. Front. Integr. Neurosci. 13, 1–16 (2019). 131. Maliphol, A. B., Garth, D. J. & Medler, K. F. Diet-induced obesity reduces the responsiveness of the peripheral taste receptor cells. PLoS One 8, (2013). 132. Hardikar, S., Wallroth, R., Villringer, A. & Ohla, K. Shorter-lived neural taste representations in obese compared to lean individuals. Sci. Rep. 8, 1–10 (2018). 133. Dielen, F. M. H. Van et al. Increased leptin concentrations correlate with increased concentrations of inflammatory markers in morbidly obese individuals. 1759–1766 (2001). 134. Umabiki, M. et al. The improvement of sweet taste sensitivity with decrease in serum leptin levels during weight loss in obese females. Tohoku J. Exp. Med. 220, 267–271 (2010). 135. Castellani, L. W., Chang, J. J., Wang, X., Lusis, A. J. & Reynolds, W. F. Transgenic mice express human MPO -463G/A alleles at atherosclerotic lesions, developing hyperlipidemia and obesity in - 463G males. J. Lipid Res. 47, 1366–1377 (2006). 136. Rossi, M. et al. Fermentation of fructooligosaccharides and inulin by bifidobacteria: A comparative study of pure and fecal cultures. Appl. Environ. Microbiol. 71, 6150–6158 (2005). 137. Corrêa-Oliveira, R., Fachi, J. L., Vieira, A., Sato, F. T. & Vinolo, M. A. R. Regulation of immune cell function by short-chain fatty acids. Clin. Transl. Immunol. 5, 1–8 (2016). 138. Fernandes, R., do Rosario, V. A., Mocellin, M. C., Kuntz, M. G. F. & Trindade, E. B. S. M. Effects of inulin-type fructans, galacto-oligosaccharides and related synbiotics on inflammatory markers in adult patients with overweight or obesity: A systematic review. Clin. Nutr. 36, 1197– 1206 (2017). 139. Weitkunat, K. et al. Short-chain fatty acids and inulin, but not guar gum, prevent diet-induced obesity and insulin resistance through differential mechanisms in mice. Sci. Rep. 7, 1–13 (2017). 140. Cani, P. D., Bibiloni, R., Knauf, C., Neyrinck, A. M. & Delzenne, N. M. Changes in gut microbiota control metabolic diet–induced obesity and diabetes in mice. Diabetes 57, 1470–81 (2008). 141. Jayashree, B. et al. Increased circulatory levels of lipopolysaccharide (LPS) and zonulin signify novel biomarkers of proinflammation in patients with type 2 diabetes. Mol. Cell. Biochem. 388, 203–210 (2014). 142. Pittman, D. W. et al. Behavioral and neurophysiological taste responses to sweet and salt are diminished in a model of subclinical intestinal inflammation. Sci. Rep. 10, 1–13 (2020). 143. Li, J., Lin, S., Vanhoutte, P. M., Woo, C. W. & Xu, A. Akkermansia muciniphila protects against atherosclerosis by preventing metabolic endotoxemia-induced inflammation in Apoe-/- Mice. Circulation 133, 2434–2446 (2016). 144. Chaudhari, N. & Roper, S. D. The cell biology of taste. J. Cell Biol. 190, 285–296 (2010). 97 145. Bartel, D. L., Sullivan, S. L., Lavoie, É. G., Sévigny, J. & Finger, T. E. Nucleoside triphosphate diphosphohydrolase-2 is the ecto-ATPase of type I cells in taste buds. J. Comp. Neurol. 497, 1–12 (2006). 146. Zhao, G. Q. et al. The receptors for mammalian sweet and umami taste. Cell 115, 255–266 (2003). 147. Chandrashekar, J. et al. T2Rs function as bitter taste receptors. Cell 100, 703–711 (2000). 148. Clapp, T. R., Yang, R., Stoick, C. L., Kinnamon, S. C. & Kinnamon, J. C. Morphologic Characterization of Rat Taste Receptor Cells That Express Components of the Phospholipase C Signaling Pathway. J. Comp. Neurol. 468, 311–321 (2004). 149. DeFazio, R. A. et al. Separate populations of receptor cells and presynaptic cells in mouse taste buds. J. Neurosci. 26, 3971–3980 (2006). 150. Kapsimali, M. & Barlow, L. A. Developing a sense of taste. Semin. Cell Dev. Biol. 24, 200–209 (2013). 151. Barlow, L. A. Progress and renewal in gustation: new insights into taste bud development. Development 142, 3620–3629 (2015). 152. Leoncini, E. et al. Adult height and head and neck cancer: A pooled analysis within the INHANCE Consortium. Head Neck 36, 1391 (2014). 153. Nguyen, H. M., Reyland, M. E. & Barlow, L. A. Mechanisms of taste bud cell loss after head and neck irradiation. J. Neurosci. 32, 3474–3484 (2012). 154. Sekulic, A. et al. Efficacy and Safety of Vismodegib in Advanced Basal-Cell Carcinoma. N. Engl. J. Med. 366, 2171–2179 (2012). 155. Kumari, A. et al. Hedgehog pathway blockade with the cancer drug LDE225 disrupts taste organs and taste sensation. 1034–1040 (2021). doi:10.1152/jn.00822.2014 156. Grivennikov, S. I., Greten, F. R. & Karin, M. Immunity, Inflammation, and Cancer. Cell 140, 883–899 (2010). 157. Argilés, J. M., Busquets, S., Stemmler, B. & López-Soriano, F. J. Cancer cachexia: Understanding the molecular basis. Nat. Rev. Cancer 14, 754–762 (2014). 158. Watt, H., Scheede-bergdahl, C., Watt, H. L., Trutschnigg, B. & Kilgour, R. D. Is IL-6 the best pro- inflammatory biomarker of clinical outcomes of cancer cachexia ? Is IL-6 the best pro-in fl ammatory biomarker of clinical outcomes of cancer cachexia ? q. (2011). doi:10.1016/j.clnu.2011.07.010 159. Krimm, R. F., Thirumangalathu, S. & Barlow, L. A. Development of the Taste System. Handb. Olfaction Gustation Third Ed. 727–748 (2015). doi:10.1002/9781118971758.ch33 160. Huang, Y. J. & Lu, K. S. TUNEL staining and electron microscopy studies of apoptotic changes in the guinea pig vallate taste cells after unilateral glossopharyngeal denervation. Anat. Embryol. (Berl). 204, 493–501 (2001). 161. Wright, H. L., Moots, R. J., Bucknall, R. C. & Edwards, S. W. Neutrophil function in inflammation and inflammatory diseases. Rheumatology 49, 1618–1631 (2010). 162. Amulic, B., Cazalet, C., Hayes, G. L., Metzler, K. D. & Zychlinsky, A. Neutrophil function: From mechanisms to disease. Annu. Rev. Immunol. 30, 459–489 (2012). 163. Pham, C. T. N. Neutrophil serine proteases: Specific regulators of inflammation. Nat. Rev. Immunol. 6, 541–550 (2006). 164. Walsh, D. E. et al. Interleukin-8 Up-regulation by Neutrophil Elastase is Mediated by MyD88/IRAK/TRAF-6 in Human Bronchial Epithelium. J. Biol. Chem. 276, 35494–35499 (2001). 165. Devaney, J. M. et al. Neutrophil elastase up-regulates interleukin-8 via toll-like receptor 4. FEBS Lett. 544, 129–132 (2003). 166. Manna, S. K., Mukhopadhyay, A., Bharat, B. & Alerts, E. This information is current as of March 25, 2013. (2013). 167. Donnahoo, K. K. et al. rapid communication. (2021). 168. Ramos, C. D. L. MIP-1 [CCL3] acting on the CCR1 receptor mediates neutrophil migration in immune inflammation via sequential release of TNF- and LTB4. J. Leukoc. Biol. 78, 167–177 98 (2005). 169. Vinolo, M. A. R. et al. Suppressive effect of short-chain fatty acids on production of proinflammatory mediators by neutrophils. J. Nutr. Biochem. 22, 849–855 (2011). 170. Tedelind, S., Westberg, F., Kjerrulf, M. & Vidal, A. Anti-inflammatory properties of the short- chain fatty acids acetate and propionate: A study with relevance to inflammatory bowel disease. World J. Gastroenterol. 13, 2826–2832 (2007). 171. Ghoshal, S., Witta, J., Zhong, J., de Villiers, W. & Eckhardt, E. Chylomicrons promote intestinal absorption of lipopolysaccharides. J. Lipid Res. 50, 90–97 (2009). 172. Harte, A. L. et al. High fat intake leads to acute postprandial exposure to circulating endotoxin in type 2 diabetic subjects. Diabetes Care 35, 375–382 (2012). 173. Creely, S. J. et al. Lipopolysaccharide activates an innate immune system response in human adipose tissue in obesity and type 2 diabetes. Am. J. Physiol. - Endocrinol. Metab. 292, 740–747 (2007). 174. Turnbaugh, P. J. et al. An obesity-associated gut microbiome with increased capacity for energy harvest. Nature 444, 1027–31 (2006). 175. Smith, K., McCoy, K. D. & Macpherson, A. J. Use of axenic animals in studying the adaptation of mammals to their commensal intestinal microbiota. Semin. Immunol. 19, 59–69 (2007). 176. Manichanh, C. et al. Reshaping the gut microbiome with bacterial transplantation and antibiotic intake. Genome Res. 20, 1411–1419 (2010). 177. Maruvada, P., Leone, V., Kaplan, L. M. & Chang, E. B. Perspective The Human Microbiome and Obesity : Moving beyond Associations. Cell Host Microbe 22, 589–599 (2017). 178. Ley, R. E. Obesity and the human microbiome. Curr. Opin. Gastroenterol. 26, 5–11 (2010). 179. Ridaura, V. K. et al. Cultured gut microbiota from twins discordant for obesity modulate adiposity and metabolic phenotypes in mice. doi:10.1126/science.1241214 180. Ley, R. E. et al. Obesity alters gut microbial ecology. Proc. Natl. Acad. Sci. U. S. A. 102, 11070–5 (2005). 181. Parada, A. E., Needham, D. M. & Fuhrman, J. A. Every base matters: Assessing small subunit rRNA primers for marine microbiomes with mock communities, time series and global field samples. Environ. Microbiol. 18, 1403–1414 (2016). 182. Apprill, A., Mcnally, S., Parsons, R. & Weber, L. Minor revision to V4 region SSU rRNA 806R gene primer greatly increases detection of SAR11 bacterioplankton. Aquat. Microb. Ecol. 75, 129– 137 (2015). 183. Bolyen E, Rideout JR, Dillon MR, Bokulich NA, Abnet CC, Al-Ghalith GA, Alexander H, Alm EJ, Arumugam M, Asnicar F, Bai Y, Bisanz JE, Bittinger K, Brejnrod A, Brislawn CJ, Brown CT, Callahan BJ, Caraballo-Rodríguez AM, Chase J, Cope EK, Da Silva R, Diener, and C. J. Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2. Nat. Biotechnol. 37, 852–857 (2019). 184. Ombrello, A. K. Dada2. Encycl. Med. Immunol. 13, 1–7 (2020). 185. McDonald, D. et al. An improved Greengenes taxonomy with explicit ranks for ecological and evolutionary analyses of bacteria and archaea. ISME J. 6, 610–8 (2012). 186. Katoh, K. & Standley, D. M. MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Mol. Biol. Evol. 30, 772–780 (2013). 187. Lane, D. 16s/23s rrna sequencing. (1991). 188. Price, M. N., Dehal, P. S. & Arkin, A. P. FastTree 2 - Approximately maximum-likelihood trees for large alignments. PLoS One 5, (2010). 189. Lozupone, C. & Knight, R. UniFrac : a New Phylogenetic Method for Comparing Microbial Communities UniFrac : a New Phylogenetic Method for Comparing Microbial Communities. Appl. Environ. Microbiol. 71, 8228–8235 (2005). 190. Douglas, G. M. et al. PICRUSt2 for prediction of metagenome functions. Nat. Biotechnol. 38, 685–688 (2020). 191. Louca, S. & Doebeli, M. Efficient comparative phylogenetics on large trees. Bioinformatics 34, 99 1053–1055 (2018). 192. Ye, Y. & Doak, T. G. A parsimony approach to biological pathway reconstruction/inference for genomes and metagenomes. PLoS Comput. Biol. 5, 1–8 (2009). 193. Mirarab, S., Nguyen, N. & Warnow, T. SEPP: SAT´ e-Enabled Phylogenetic Placement. 247–258 194. Faith, D. P. Conservation evaluation and phylogenetic diversity. Biol. Conserv. 61, 1–10 (1992). 195. Du, H., Zhao, A., Wang, Q., Yang, X. & Ren, D. Supplementation of Inulin with Various Degree of Polymerization Ameliorates Liver Injury and Gut Microbiota Dysbiosis in High Fat-Fed Obese Mice. J. Agric. Food Chem. 68, 779–787 (2020). 196. Anitha, M. et al. Intestinal Dysbiosis Contributes to the Delayed Gastrointestinal Transit in High- Fat Diet Fed Mice. Cmgh 2, 328–339 (2016). 197. Finucane, M. M., Sharpton, T. J., Laurent, T. J. & Pollard, K. S. A taxonomic signature of obesity in the microbiome? Getting to the guts of the matter. PLoS One 9, 1–5 (2014). 198. Bhattarai, Y. & Kashyap, P. C. Germ-Free Mice Model for Studying Host--Microbial Interactions. in Mouse Models for Drug Discovery: Methods and Protocols (eds. Proetzel, G. & Wiles, M. V) 123–135 (Springer New York, 2016). doi:10.1007/978-1-4939-3661-8_8 199. Round, J. L. & Mazmanian, S. K. The gut microbiota shapes intestinal immune responses during health and disease. Nat. Rev. Immunol. 9, 313–323 (2009). 200. Olszak, T. et al. NIH Public Access. 336, 489–493 (2012). 201. Sun, J. et al. Fecal microbiota transplantation alleviated Alzheimer’s disease-like pathogenesis in APP/PS1 transgenic mice. Transl. Psychiatry 9, (2019). 202. Bárcena, C. et al. Healthspan and lifespan extension by fecal microbiota transplantation into progeroid mice. Nat. Med. 25, 1234–1242 (2019). 203. Zhou, D. et al. Total fecal microbiota transplantation alleviates high-fat diet-induced steatohepatitis in mice via beneficial regulation of gut microbiota. Sci. Rep. 7, 1–11 (2017). 204. Barba, C. et al. Effects of Fecal Microbiota Transplantation on Composition in Mice with CKD. Toxins (Basel). 12, 1–12 (2020). 205. Wrzosek, L. et al. Transplantation of human microbiota into conventional mice durably reshapes the gut microbiota. Sci. Rep. 8, 1–9 (2018). 206. Knights, D. & Hutkins, R. W. Stable Engraftment of Bifidobacterium longum AH1206 in the Human Gut Depends on Individualized Features of the Resident Microbiome Article Stable Engraftment of Bifidobacterium longum AH1206 in the Human Gut Depends on Individualized Features of the Resid. 515–526 (2016). doi:10.1016/j.chom.2016.09.001 207. Li, S. S. et al. Durable coexistence ofdonor and recipient strains after fecal microbiota transplantation. 352, 586–590 (2016). 208. Ducarmon, Q. R. et al. Gut Microbiota and Colonization Resistance against Bacterial Enteric Infection. Microbiol. Mol. Biol. Rev. 83, 1–29 (2019). 209. Stecher, B. et al. Salmonella enterica serovar typhimurium exploits inflammation to compete with the intestinal microbiota. PLoS Biol. 5, 2177–2189 (2007). 210. Derrien, M., Vaughan, E. E., Plugge, C. M. & Vos, W. M. De. a human intestinal mucin- degrading bacterium. 1469–1476 (2018). doi:10.1099/ijs.0.02873-0 211. Reunanen, J. et al. Akkermansia muciniphila adheres to enterocytes and strengthens the integrity of the epithelial cell layer. Appl. Environ. Microbiol. 81, 3655–3662 (2015). 212. Collado, M. C., Derrien, M., Isolauri, E., De Vos, W. M. & Salminen, S. Intestinal integrity and Akkermansia muciniphila, a mucin-degrading member of the intestinal microbiota present in infants, adults, and the elderly. Appl. Environ. Microbiol. 73, 7767–7770 (2007). 213. Brown, C. T. et al. Gut microbiome metagenomics analysis suggests a functional model for the development of autoimmunity for type 1 diabetes. PLoS One 6, 1–9 (2011). 214. Png, C. W. et al. Mucolytic bacteria with increased prevalence in IBD mucosa augment in vitro utilization of mucin by other bacteria. Am. J. Gastroenterol. 105, 2420–2428 (2010). 215. Shin, N. R. et al. An increase in the Akkermansia spp. population induced by metformin treatment improves glucose homeostasis in diet-induced obese mice. Gut 63, 727–735 (2014). 100 216. Wang, K. et al. Parabacteroides distasonis Alleviates Obesity and Metabolic Dysfunctions via Production of Succinate and Secondary Bile Acids. Cell Rep. 26, 222-235.e5 (2019). 217. Koh, G. Y., Kane, A. V., Wu, X. & Crott, J. W. Parabacteroides distasonis attenuates tumorigenesis, modulates inflammatory markers and promotes intestinal barrier integrity in azoxymethane-treated A/J mice. Carcinogenesis 41, 909–917 (2021). 218. Deehan, E. C. et al. Precision Microbiome Modulation with Discrete Dietary Fiber Structures Directs Short-Chain Fatty Acid Production. Cell Host Microbe 27, 389-404.e6 (2020). 219. Tong, L. C. et al. Propionate ameliorates dextran sodium sulfate-induced colitis by improving intestinal barrier function and reducing inflammation and oxidative stress. Front. Pharmacol. 7, 1– 9 (2016). 220. Asarat, M., Vasiljevic, T., Apostolopoulos, V. & Donkor, O. Short-Chain Fatty Acids Regulate Secretion of IL-8 from Human Intestinal Epithelial Cell Lines in vitro. Immunol. Invest. 44, 678– 693 (2015). 221. Kelly, C. J. et al. Crosstalk between microbiota-derived short-chain fatty acids and intestinal epithelial HIF augments tissue barrier function. Cell Host Microbe 17, 662–671 (2015). 222. Caballero, S. et al. Cooperating Commensals Restore Colonization Resistance to Vancomycin- Resistant Enterococcus faecium. Cell Host Microbe 21, 592-602.e4 (2017). 223. Warren, Y. A., Tyrrell, K. L., Citron, D. M. & Goldstein, E. J. C. Clostridium aldenense sp. nov. and Clostridium citroniae sp. nov. isolated from human clinical infections. J. Clin. Microbiol. 44, 2416–2422 (2006). 224. Mangin, I. et al. Molecular inventory of faecal microflora in patients with Crohn’s disease. FEMS Microbiol. Ecol. 50, 25–36 (2004). 225. Wang, L. et al. Increased abundance of Sutterella spp. and Ruminococcus torques in feces of children with autism spectrum disorder. Mol. Autism 4, 12–15 (2013). 226. Mukhopadhya, I. et al. A comprehensive evaluation of colonic mucosal isolates of sutterella wadsworthensis from inflammatory bowel disease. PLoS One 6, 1–10 (2011). 227. Kaakoush, N. O. Sutterella Species, IgA-degrading Bacteria in Ulcerative Colitis. Trends Microbiol. 28, 519–522 (2020). 228. Paramsothy, S. et al. Specific Bacteria and Metabolites Associated With Response to Fecal Microbiota Transplantation in Patients With Ulcerative Colitis. Gastroenterology 156, 1440- 1454.e2 (2019). 229. Moon, C. et al. Vertically transmitted faecal IgA levels determine extra-chromosomal phenotypic variation. Nature 521, 90–93 (2015). 230. Větrovský, T. & Baldrian, P. The Variability of the 16S rRNA Gene in Bacterial Genomes and Its Consequences for Bacterial Community Analyses. PLoS One 8, 1–10 (2013). 231. Jovel, J. et al. Characterization of the gut microbiome using 16S or shotgun metagenomics. Front. Microbiol. 7, 1–17 (2016). 232. Kuperman, A. A. et al. Deep microbial analysis of multiple placentas shows no evidence for a placental microbiome. BJOG An Int. J. Obstet. Gynaecol. 127, 159–169 (2020). 233. Kliman, H. J. Comment on ‘The placenta harbors a unique microbiome’. Sci. Transl. Med. 6, (2014). 234. Round, J. L., O’Connell, R. M. & Mazmanian, S. K. Coordination of tolerogenic immune responses by the commensal microbiota. J. Autoimmun. 34, (2010). 235. Chow, J. & Mazmanian, S. K. Getting the Bugs out of the Immune System: Do Bacterial Microbiota ‘Fix’ Intestinal T Cell Responses? Cell Host Microbe 5, 8–12 (2009). 236. Mazmanian, S. K., Cui, H. L., Tzianabos, A. O. & Kasper, D. L. An immunomodulatory molecule of symbiotic bacteria directs maturation of the host immune system. Cell 122, 107–118 (2005). 237. Han, D. et al. Dendritic Cell Expression of the Signaling Molecule TRAF6 Is Critical for Gut Microbiota-Dependent Immune Tolerance. Immunity 38, 1211–1222 (2013). 238. MacPherson, A. J., McCoy, K. D., Johansen, F. E. & Brandtzaeg, P. The immune geography of IgA induction and function. Mucosal Immunol. 1, 11–22 (2008). 101 239. Lindner, C. et al. Age, microbiota, and T cells shape diverse individual iga repertoires in the intestine. J. Exp. Med. 209, 365–377 (2012). 240. McCoy, K. D., Burkhard, R. & Geuking, M. B. The microbiome and immune memory formation. Immunol. Cell Biol. 97, 625–635 (2019). 241. Ivanov, I. I. et al. NIH Public Access. 139, 485–498 (2010). 242. Geuking, M. B. et al. Intestinal Bacterial Colonization Induces Mutualistic Regulatory T Cell Responses. Immunity 34, 794–806 (2011). 243. Schloss, P. D. et al. Stabilization of the murine gut microbiome following weaning. Gut Microbes 3, (2012). 244. Hansen, C. H. F. et al. Patterns of early gut colonization shape future immune responses of the host. PLoS One 7, 1–7 (2012). 245. Roopchand, D. E. et al. Dietary polyphenols promote growth of the gut bacterium akkermansia muciniphila and attenuate high-fat diet-induced metabolic syndrome. Diabetes 64, 2847–2858 (2015). 246. Zhu, L. et al. Berberine treatment increases Akkermansia in the gut and improves high-fat diet- induced atherosclerosis in Apoe−/−mice. Atherosclerosis 268, 117–126 (2018). 247. Tillhon, M., Guamán Ortiz, L. M., Lombardi, P. & Scovassi, A. I. Berberine: New perspectives for old remedies. Biochem. Pharmacol. 84, 1260–1267 (2012). 248. Habtemariam, S. Berberine and inflammatory bowel disease: A concise review. Pharmacol. Res. 113, 592–599 (2016). 249. Tabeshpour, J., Imenshahidi, M. & Hosseinzadeh, H. A review of the effects of berberis vulgaris and its major component, berberine, in metabolic syndrome. Iran. J. Basic Med. Sci. 20, 557–568 (2017). 102